Exopalaemon carinicauda compound eye development regulation gene and guide RNA, and acquisition and application thereof
A kind of white shrimp, regulation gene technology
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Example 1 Cloning and analysis of the compound eye development regulatory gene EcEy of the white shrimp
[0044] (1) Extraction of total RNA from white shrimp
[0045] For the extraction method of total RNA, refer to the instructions provided by RNAiso Plus (Takara, Cat. No. 9108). The total RNA of the white shrimp was extracted, and the RNA concentration was measured using a NanoDrop 2000 spectrophotometer (Thermo), followed by agarose gel electrophoresis to check its quality, and stored at -80°C.
[0046] (2) cDNA reverse transcription
[0047] For DNase I digestion and extraction of RNA samples and reverse transcription to synthesize first-strand cDNA, refer to RevertAid FirstStrand cDNA Synthesis Kit (Thermo, K1622). The size and integrity of the PCR product were detected by gel electrophoresis of the obtained cDNA product.
[0048] (3) Full-length cDNA clone of EcEy gene
[0049] According to the transcriptome sequencing information of the white shrimp obtained...
Embodiment 2
[0071] Example 2 The gRNA synthesis and gene editing experiment of the compound eye development regulation gene EcEy of the white shrimp
[0072] (1) gRNA synthesis of the compound eye development regulatory gene EcEy in the white shrimp
[0073] a) gRNA framework construction
[0074] First, design and synthesize the gRNA framework sequence according to the structure of the gRNA:
[0075] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT
[0076] Then the framework sequence was ligated into the pMD19-T vector (TaKaRa, D102A) to construct the gRNA framework plasmid pMD19-gRNA.
[0077] b) Synthesis of gRNA template
[0078] Using the online tool CRISPRdirect ( http: / / crispr.dbcls.jp / ) to select the gRNA target site of the EcEy gene. Design the corresponding gRNA-F according to the target sequence, and design the gRNA-R of the reverse primer at the same time.
[0079] gRNA-F:
[0080] TAATACGACTCACTATAGCTCGATGATCTTCTGCCTGGGTTTTTAGAGCTAGA...
Embodiment 3
[0100] Example 3 Application of EcEy, the compound eye development regulatory gene of the white shrimp, in the establishment of gene editing platforms for other decapod animals
[0101] (1) Obtaining the homologous sequence of EcEy gene
[0102] By comparing the EcEy gene of the white shrimp and other decapod animals such as Litopenaeus vannamei, Crayfish red claw, Procambarus clarkii and other species published transcriptome sequencing data, according to the homologous conserved sequence ( figure 2 ), design the full-length sequence amplification primer Ey-FL-F / R of the homologous gene, carry out PCR amplification, obtain the homologous sequence of the EcEy gene of other decapod animals (detailed steps are the same as embodiment 1). This example takes the giant long arm shrimp as an example.
[0103] The primer sequences are as follows:
[0104] Ey-FL-F:GAGCCGTTTACTAAAGACCTG
[0105] Ey-FL-R: ACAAAATCCAGACTGAACTACAC
[0106] (2) Synthetic gRNA
[0107] According to the ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com