Exopalaemon carinicauda compound eye development regulation gene and guide RNA, and acquisition and application thereof

A kind of white shrimp, regulation gene technology

Active Publication Date: 2020-10-30
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current gene editing research of the white shrimp has lacked effective marker genes, which should have obvious mutant phenotypes, and should be observed in the early stages of development, which can be used as a sign of the success of the gene editing operation.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Exopalaemon carinicauda compound eye development regulation gene and guide RNA, and acquisition and application thereof
  • Exopalaemon carinicauda compound eye development regulation gene and guide RNA, and acquisition and application thereof
  • Exopalaemon carinicauda compound eye development regulation gene and guide RNA, and acquisition and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1 Cloning and analysis of the compound eye development regulatory gene EcEy of the white shrimp

[0044] (1) Extraction of total RNA from white shrimp

[0045] For the extraction method of total RNA, refer to the instructions provided by RNAiso Plus (Takara, Cat. No. 9108). The total RNA of the white shrimp was extracted, and the RNA concentration was measured using a NanoDrop 2000 spectrophotometer (Thermo), followed by agarose gel electrophoresis to check its quality, and stored at -80°C.

[0046] (2) cDNA reverse transcription

[0047] For DNase I digestion and extraction of RNA samples and reverse transcription to synthesize first-strand cDNA, refer to RevertAid FirstStrand cDNA Synthesis Kit (Thermo, K1622). The size and integrity of the PCR product were detected by gel electrophoresis of the obtained cDNA product.

[0048] (3) Full-length cDNA clone of EcEy gene

[0049] According to the transcriptome sequencing information of the white shrimp obtained...

Embodiment 2

[0071] Example 2 The gRNA synthesis and gene editing experiment of the compound eye development regulation gene EcEy of the white shrimp

[0072] (1) gRNA synthesis of the compound eye development regulatory gene EcEy in the white shrimp

[0073] a) gRNA framework construction

[0074] First, design and synthesize the gRNA framework sequence according to the structure of the gRNA:

[0075] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT

[0076] Then the framework sequence was ligated into the pMD19-T vector (TaKaRa, D102A) to construct the gRNA framework plasmid pMD19-gRNA.

[0077] b) Synthesis of gRNA template

[0078] Using the online tool CRISPRdirect ( http: / / crispr.dbcls.jp / ) to select the gRNA target site of the EcEy gene. Design the corresponding gRNA-F according to the target sequence, and design the gRNA-R of the reverse primer at the same time.

[0079] gRNA-F:

[0080] TAATACGACTCACTATAGCTCGATGATCTTCTGCCTGGGTTTTTAGAGCTAGA...

Embodiment 3

[0100] Example 3 Application of EcEy, the compound eye development regulatory gene of the white shrimp, in the establishment of gene editing platforms for other decapod animals

[0101] (1) Obtaining the homologous sequence of EcEy gene

[0102] By comparing the EcEy gene of the white shrimp and other decapod animals such as Litopenaeus vannamei, Crayfish red claw, Procambarus clarkii and other species published transcriptome sequencing data, according to the homologous conserved sequence ( figure 2 ), design the full-length sequence amplification primer Ey-FL-F / R of the homologous gene, carry out PCR amplification, obtain the homologous sequence of the EcEy gene of other decapod animals (detailed steps are the same as embodiment 1). This example takes the giant long arm shrimp as an example.

[0103] The primer sequences are as follows:

[0104] Ey-FL-F:GAGCCGTTTACTAAAGACCTG

[0105] Ey-FL-R: ACAAAATCCAGACTGAACTACAC

[0106] (2) Synthetic gRNA

[0107] According to the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an exopalaemon carinicauda compound eye development regulation gene EcEy which can generate obvious phenotypic change in an embryo period after being successfully edited so asto indicate the success rate of gene editing operation, and the gene can also be applied to the establishment of gene editing platforms of other decapod crustaceans. The EcEy gene of the exopalaemoncarinicauda has a nucleotide sequence shown as SEQ ID No. 1 in a sequence list; the guide RNA (gRNA) designed and synthesized on the basis of the sequence has a ribonucleic acid sequence shown as SEQID No.2 in a sequence list; EcEy-gRNA and commercial Cas 9 mRNA are mixed and injected into fertilized eggs of exopalaemon carinicauda, a PAX structural domain of an EcEy gene can be specifically recognized and cut, and an obvious compound eye defect phenotype is observed in the early stage of embryonic development. The EcEy gene can be used as a target gene for gene editing research of exopalaemon carinicauda, is used for verifying whether gene editing operation succeeds or not, and can also be used for establishing gene editing platforms of other decades of crustaceans.

Description

technical field [0001] The invention relates to the technical field of genetic engineering of the white prawn, in particular to the acquisition of a compound eye development regulation gene and guide RNA of the white prawn and its application in gene editing research of decapod crustaceans. Background technique [0002] Exopalaemon carinicauda belongs to the crustacean subphylum Decapoda. It is a marine shrimp with high economic value. It is also one of the research models of decapod animals. It is the only one that has been reported Decapod animals capable of gene editing operations have the advantages of strong environmental adaptability, strong reproductive ability, easy artificial rearing, female shrimp can continuously lay eggs, and large and transparent embryos. The study of gene editing of the spinytail shrimp can be used to reveal the rules of life activities such as development, growth, metabolism and reproduction of decapod animals. However, the current research o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/12C12N15/10C12N15/113C12N15/90C12N5/10A01K67/033
CPCC07K14/47C12N15/902C12N15/113A01K67/0338C12N2310/10A01K2227/70A01K2267/03
Inventor高羿李富花张晓军相建海
OwnerINST OF OCEANOLOGY - CHINESE ACAD OF SCI