A kind of liposome-dna complex body and application thereof
A technology of liposomes and complexes, applied in the field of nanomaterials, can solve the problems of being easily affected by other factors, expensive detection costs, low detection limits, etc., and achieve the effects of good stability, easy operation, and short detection time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] A liposome-DNA complex comprises 3 kinds of DNA chains and liposomes, and the DNA chains are specifically:
[0032] DNA strand A is Hairpin-A:
[0033]GAGCGTATAGGTTGCGTGCAGTAAGGCATATGGATACTGCACGCAACCTGCCA;
[0034] DNA strand B is SH-Hairpin-B-BHQ / FAM:
[0035] SH-TTCGAGTGCAGTATCC / FAM / ATATGCCTTACTGCACGCAACCTAGGCATAT / BHQ / GGA;
[0036] DNA chain C is Sgc8-trigger:
[0037] ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGATACTGCACGCAACCTATACGCTC.
[0038] Its preparation method comprises the following steps:
[0039] (1) First, dilute the three DNA strands with 1×TE Buffer to obtain Hairpin-A solution, SH-Hairpin-B-BHQ / FAM solution, Sgc8-trigger solution, and all DNA strand solutions with a final concentration of 10 μM No further processing is required;
[0040] (2) Then, incubate 2 μL Hairpin-A solution and 2 μL Sgc8-trigger solution in 34 μL pH7.4 1×TAMg buffer for 30 min at room temperature, and then add 2 μL SH-Hairpin-B-BHQ / FAM solution Put it into the mixture o...
Embodiment 2
[0043] Example 2, a dual hairpin cycle amplification strategy for highly sensitive detection of cancer cell markers.
[0044] First, use 1×TE Buffer to dilute 10 μM Sgc8-trigger chain (which specifically binds to the receptor protein on the surface of cancer cells, so the detection of cancer cells can be equivalently converted to the detection of Sgc8-trigger) into different concentrations of Sgc8-trigger chains (concentrations of 4 μM, 2 μM, 1 μM, 0.5 μM and 0.25 μM, respectively) were used as detection targets. Then add 2 μL of 10 μM Hairpin-A solution to the 2uLSgc8-trigger chain solution, at this time the Sgc8-trigger chain will open the hairpin structure of Hairpin-A, which is complementary to the DNA chain B (SH-Hairpin-B-BHQ / FAM) area will be exposed. After the Sgc8-trigger chain was reacted with Hairpin-A for 0.5h, 2 μL of 10 μM SH-Hairpin-B-BHQ / FAM solution was added to it, and Hairpin-A would open the stem-loop of Hairpin-B at this time. When the two hairpin struct...
Embodiment 3
[0046] Example 3, a liposome-DNA complex recycling signal amplification strategy and its application in highly sensitive detection of cancer cell markers.
[0047] First, maleimide-modified liposomes (MAL-LP) were synthesized using DOPE:DC-Chol:DOPE-PEG-Mal = 1:1:0.1 (molar ratio). Then, the DNA mixture was added into the trichloroethyl phosphate, and after co-incubating for 4 hours, the detection performance was tested.
[0048] The specific steps are as follows: First, use 1×TE Buffer to dilute 10 μM Sgc8-trigger chain (specifically binds to the receptor protein on the surface of cancer cells, therefore, the detection of cancer cells can be equivalently converted to the detection of Sgc8-trigger) Sgc8-trigger chains at different concentrations (4 μM, 2 μM, 1 μM, 0.5 μM and 0.25 μM, respectively) were used as detection targets. Then add 2 μL of 10 μM Hairpin-A solution to the Sgc8-trigger chain solution, at this time the Sgc8-trigger chain will open the hairpin structure of ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


