Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of liposome-dna complex body and application thereof

A technology of liposomes and complexes, applied in the field of nanomaterials, can solve the problems of being easily affected by other factors, expensive detection costs, low detection limits, etc., and achieve the effects of good stability, easy operation, and short detection time

Active Publication Date: 2021-11-30
FUZHOU UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For the early detection of cancer, the common method is to use blood or urine for detection. This type of detection method has a low detection limit, is easily affected by other factors, and requires the cooperation of large instruments; in addition, the detection is expensive and takes a long time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of liposome-dna complex body and application thereof
  • A kind of liposome-dna complex body and application thereof
  • A kind of liposome-dna complex body and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] A liposome-DNA complex comprises 3 kinds of DNA chains and liposomes, and the DNA chains are specifically:

[0032] DNA strand A is Hairpin-A:

[0033]GAGCGTATAGGTTGCGTGCAGTAAGGCATATGGATACTGCACGCAACCTGCCA;

[0034] DNA strand B is SH-Hairpin-B-BHQ / FAM:

[0035] SH-TTCGAGTGCAGTATCC / FAM / ATATGCCTTACTGCACGCAACCTAGGCATAT / BHQ / GGA;

[0036] DNA chain C is Sgc8-trigger:

[0037] ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGATACTGCACGCAACCTATACGCTC.

[0038] Its preparation method comprises the following steps:

[0039] (1) First, dilute the three DNA strands with 1×TE Buffer to obtain Hairpin-A solution, SH-Hairpin-B-BHQ / FAM solution, Sgc8-trigger solution, and all DNA strand solutions with a final concentration of 10 μM No further processing is required;

[0040] (2) Then, incubate 2 μL Hairpin-A solution and 2 μL Sgc8-trigger solution in 34 μL pH7.4 1×TAMg buffer for 30 min at room temperature, and then add 2 μL SH-Hairpin-B-BHQ / FAM solution Put it into the mixture o...

Embodiment 2

[0043] Example 2, a dual hairpin cycle amplification strategy for highly sensitive detection of cancer cell markers.

[0044] First, use 1×TE Buffer to dilute 10 μM Sgc8-trigger chain (which specifically binds to the receptor protein on the surface of cancer cells, so the detection of cancer cells can be equivalently converted to the detection of Sgc8-trigger) into different concentrations of Sgc8-trigger chains (concentrations of 4 μM, 2 μM, 1 μM, 0.5 μM and 0.25 μM, respectively) were used as detection targets. Then add 2 μL of 10 μM Hairpin-A solution to the 2uLSgc8-trigger chain solution, at this time the Sgc8-trigger chain will open the hairpin structure of Hairpin-A, which is complementary to the DNA chain B (SH-Hairpin-B-BHQ / FAM) area will be exposed. After the Sgc8-trigger chain was reacted with Hairpin-A for 0.5h, 2 μL of 10 μM SH-Hairpin-B-BHQ / FAM solution was added to it, and Hairpin-A would open the stem-loop of Hairpin-B at this time. When the two hairpin struct...

Embodiment 3

[0046] Example 3, a liposome-DNA complex recycling signal amplification strategy and its application in highly sensitive detection of cancer cell markers.

[0047] First, maleimide-modified liposomes (MAL-LP) were synthesized using DOPE:DC-Chol:DOPE-PEG-Mal = 1:1:0.1 (molar ratio). Then, the DNA mixture was added into the trichloroethyl phosphate, and after co-incubating for 4 hours, the detection performance was tested.

[0048] The specific steps are as follows: First, use 1×TE Buffer to dilute 10 μM Sgc8-trigger chain (specifically binds to the receptor protein on the surface of cancer cells, therefore, the detection of cancer cells can be equivalently converted to the detection of Sgc8-trigger) Sgc8-trigger chains at different concentrations (4 μM, 2 μM, 1 μM, 0.5 μM and 0.25 μM, respectively) were used as detection targets. Then add 2 μL of 10 μM Hairpin-A solution to the Sgc8-trigger chain solution, at this time the Sgc8-trigger chain will open the hairpin structure of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a liposome-DNA complex and an application thereof, belonging to the technical field of nanomaterials. The present invention designs a double-hairpin structure based on the principle of complementary pairing of DNA bases, and utilizes a double-hairpin cycle opening strategy to perform highly sensitive detection of cancer cell markers. Liposomes with high biocompatibility are used as the basic carrier, which can be used for in vivo detection. The main advantages are: the DNA double hair card detection strategy can effectively avoid the occurrence of false positives and improve the specificity of detection; the double hair card and target chain cycle amplification strategy can further improve the detection sensitivity; the use of FAM group and BHQ group The fluorescence energy resonance transfer of the group is used to give the signal of biomolecular hybridization, and the signal can be detected by using a basic fluorescence instrument; the detection of cancer cell markers in vivo can be performed by using the liposome-DNA complex.

Description

technical field [0001] The invention belongs to the technical field of nanometer materials, and relates to a liposome-DNA complex and an application thereof. Background technique [0002] As the carrier of genetic information, DNA is highly addressable and programmable, and its assembly can be controlled by the Watson-Crick base pairing principle. When normal cells become diseased, they will cause some physiological dysfunction, such as the production of a series of abnormal biomarkers and changes in intracellular pH. These factors are also important indicators currently used by researchers to predict cancer. For the early detection of cancer, the common method is to use blood or urine for detection. This type of detection method has a low detection limit, is easily affected by other factors, and requires the cooperation of large-scale instruments; in addition, the detection is expensive and takes a long time. These factors are also the main reasons for its slow development...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/682
CPCC12Q1/682C12Q2525/301C12Q2563/107C12Q2563/161
Inventor 吴再生王伟军陈燕茹吴静挺
Owner FUZHOU UNIV