Agrobacterium-mediated flowering cabbage genetic transformation method

A genetic transformation method and technology mediated by Agrobacterium, applied in the field of genetic transformation of cabbage mediated by Agrobacterium, can solve the problems affecting the application of genetic engineering, low regeneration rate, difficulty in regeneration of adventitious buds, etc., and achieve low pollution rate, comprehensive High performance, simple and efficient operation

Inactive Publication Date: 2020-11-06
SOUTH CHINA AGRI UNIV
View PDF5 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] After the 1980s, Chinese cabbage tissue culture and high-frequency regeneration system of plants were gradually established. On this basis, transgenic research has also made some progress, but it mainly focused on the genetic transformation of Chinese cabbage. The successful genetic transformation of Chinese cabbage few reports
[0004] Cabbage crops carrying the AA genotype belong to Brassica species with a relatively low regeneration rate, and their adventitious buds are difficult to regenerate, and Agrobacterium is not easily infected, which affects the application of genetic engineering in the improvement of cabbage varieties

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Agrobacterium-mediated flowering cabbage genetic transformation method
  • Agrobacterium-mediated flowering cabbage genetic transformation method
  • Agrobacterium-mediated flowering cabbage genetic transformation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] 1. Materials

[0043] 1.1 Plant material

[0044] The experiment was carried out from July 2018 to June 2019 in the Vegetable Cultivation and Physiology Laboratory, Molecular Laboratory and Tissue Culture Laboratory of the College of Horticulture, South China Agricultural University. The variety of Chinese cabbage tested was "Youlu 501", which was bred by the Guangzhou Academy of Agricultural Sciences, and the seeds were self-bred for multiple generations in our laboratory.

[0045] 1.2 Medium

[0046] Table 1 medium formula

[0047]

[0048] 1.3 Agrobacterium

[0049] Escherichia coli strains were DH5α (Vazyme), Agrobacterium GV3101 (Vidi), and the plant overexpression vector was pCAMBIA3301 (Dingguo).

[0050] 1.4 Detection primers

[0051] The sequence of the primer Bar gene used for the detection of Chinese cabbage positive seedlings is:

[0052] Bar-F: ATGAGCCCAGAACGACGCC;

[0053] Bar-R:TCAAATCTCGGTGACGGGCA;

[0054] 2. Test method

[0055] 2.1 Genetic...

Embodiment 2

[0080] Example 2 Infection Concentration

[0081] 1. Materials

[0082] 1.1 plant material: same as embodiment 1;

[0083] 1.2 culture medium: same as embodiment 1;

[0084] 1.3 Agrobacterium: same as Example 1;

[0085] 1.4 Detection primers: same as Example 1;

[0086] 2. Test method

[0087] 2.1 Genetic transformation steps of Chinese cabbage

[0088] Take the stipe cotyledons of aseptic seedlings of Chinese cabbage with a seedling age of 3 days as explants, and pre-cultivate them for 3 days; expand and shake the Agrobacterium containing pCAMBIA3301 carrier in LB liquid medium, centrifuge at 4000rpm for 15min, and discard the supernatant; Resuspend the bacteria in the staining medium to make the optical density OD 600 adjusted to different concentrations (OD 600 0.3~0.4, 0.4~0.5, 0.5~0.6, 0.6~0.7, 0.7~0.8), then 28°C, 200rpm shaking culture for 4h to obtain the Agrobacterium infection solution and infect it, and the remaining steps are consistent with Example 1 ;

...

Embodiment 3

[0095] Example 3 Infection time

[0096] 1. Materials

[0097] 1.1 plant material: same as embodiment 1;

[0098] 1.2 culture medium: same as embodiment 1;

[0099] 1.3 Agrobacterium: same as Example 1;

[0100] 1.4 Detection primers: same as Example 1;

[0101] 2. Test method

[0102] 2.1 Genetic transformation steps of Chinese cabbage

[0103] The petiolate cotyledons of aseptic seedlings of Chinese cabbage with a seedling age of 3 days were taken as explants, pre-cultivated for 3 days, and infected with the prepared Agrobacterium infection solution for 5 minutes, 10 minutes, and 15 minutes respectively. All the other steps are consistent with embodiment 1;

[0104] 2.2 Detection of transgenic plants: same as Example 1;

[0105] 3. Results and Analysis

[0106] Infection time has a great influence on the effect of transgenic transformation of Chinese cabbage. If the infection time is too short, the transformation rate is low, but there are many clustered buds, the f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
lengthaaaaaaaaaa
Login to View More

Abstract

The invention relates to the field of plant genetic engineering application, in particular to an agrobacterium-mediated flowering cabbage genetic transformation method. The method comprises the following steps: performing surface disinfection on flowering cabbage seeds, culturing the seeds on a sowing culture medium, and performing pre-culture, infection, co-culture, recovery culture and subculture by taking cotyledons with petiole of aseptic seedlings with the seedling age of 3 days as explants; transferring adventitious buds subjected to subculture into a rooting culture medium for rooting culture to obtain tissue culture seedlings, opening bottles for hardening the tissue culture seedlings in one step, and performing normal management to obtain transgenic plants. According to the method, flowering cabbages are taken as materials, a flowering cabbage genetic transformation system is constructed, the transgenic plants are obtained, the operation is simple and efficient, the pollutionrate is low, the comprehensive performance is high, and a foundation is laid for genetic function research and molecular breeding of brassica plants.

Description

technical field [0001] The invention relates to the application field of plant genetic engineering, in particular to an Agrobacterium-mediated genetic transformation method of Chinese cabbage. Background technique [0002] Caixin (Brassica campestris L.ssp.chinensis var.utilis Tsen et Lee) is a variety of Brassicaceae Brassica subspecies. It is the vegetable with the largest cultivation area and yield in South China. Caixin takes cabbage as the main edible organ. It is tender in quality, unique in flavor and rich in nutrition, and is loved by consumers. It has wide adaptability, short growth cycle, and can be used for annual production. It occupies an important position in vegetable supply. [0003] After the 1980s, Chinese cabbage tissue culture and high-frequency regeneration system of plants were gradually established. On this basis, transgenic research has also made some progress, but it mainly focused on the genetic transformation of Chinese cabbage. The successful gene...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/82A01H5/00A01H6/20A01H4/00
CPCA01H4/001A01H4/008C12N15/8205
Inventor苏蔚梁雯雯宋世威郝彦伟陈日远刘厚诚孙光闻
OwnerSOUTH CHINA AGRI UNIV