Unlock instant, AI-driven research and patent intelligence for your innovation.

Plasma free DNA lung cancer gene combined detection kit

A combined detection and kit technology, applied in the field of molecular biology, can solve the problems of inability to detect oncogenic fusion genes and point mutations, large sample volume, and complicated operations.

Active Publication Date: 2020-12-18
苏州科贝生物技术有限公司
View PDF6 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Patent CN111235272A discloses a composition for one-time detection of multiple gene mutations in lung cancer, but two PCR 8-tube tubes are used in the detection, one for fusion gene detection and the other for mutation detection, requiring a large amount of samples and relatively difficult operation complex
[0006] In summary, the above detection methods can only detect known gene fusions or point mutations, and are limited by the detection throughput, and cannot realize one-time full detection of oncogenic fusion genes and point mutations. Therefore, the development of a A kit that can simultaneously detect fusion genes and point mutations is of great significance for clinical research and early diagnosis of lung cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plasma free DNA lung cancer gene combined detection kit
  • Plasma free DNA lung cancer gene combined detection kit
  • Plasma free DNA lung cancer gene combined detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0117] Example 1 Design of special adapters for DNA library construction, specific compound primers for detecting fusion genes and point mutations, and amplification compound primers

[0118] 1. Special adapters for DNA library construction

[0119] A special linker for DNA library construction, which is 8 dimers composed of linker primer 1 and 8 different i5-terminal primers respectively. The sequences of linker primer 1 and 8 different i5-terminal primers are shown in Table 4.

[0120] Table 4 Sequence list of special linker primers

[0121] Primer name Primer sequence 5_index sequence SEQ ID NO Adapter Primer 1 GATCGGAAGAGCCACATACTGA - SEQ ID NO: 1 Primer 1 at i5 end AATGATACGGCGACCACCGAGATCTACACCCTCTCTATACACTCTTTCCCTACACGACGCTCTTCCGATCT CTCT CTAT SEQ ID NO: 2 Primer 2 at i5 end AATGATACGGCGACCACCGAGATCTACACTATCCCTCTACACTCTTTCCCTACACGACGCTCTTCCGATCT TATC CTCT SEQ ID NO: 3 Primer 3 at the i5 end AATGATACGGCGACCACCGAGATC...

Embodiment 2

[0137] Example 2 Kit and detection method for joint detection of plasma cell-free DNA lung cancer-related fusion genes or mutations

[0138] A kit for combined detection of plasma cell-free DNA lung cancer-related fusion genes or mutations, including Example 1: (1) special adapters for DNA library construction; (2) specific compound primers for detection of fusion genes and point mutations; (3 ) library amplification compound primers.

[0139] The above kit also includes: DNA fragmentation / end repair / dA addition reagent set; DNA ligation reagent set; PCR amplification reagent set; high-fidelity hot-start PCR amplification reagent set.

[0140] Wherein, the DNA fragmentation / end repair / dA addition reagent set includes end repair mixture. The DNA ligation reagent set includes 5× ligase buffer, TIANSeq DNA ligase, special adapters and ultrapure water. The PCR amplification reagent set includes 5×multiple PCR reaction enzyme mixture and PCR primers. High-fidelity hot-start PCR ...

experiment example 1

[0213] The steps described in Example 2 of the present invention were used to detect lung cancer blood samples. The following experiments were performed with the informed consent of the patients themselves.

[0214] 1. Sample 1: The source is the clinical sample of Yunnan Cancer Hospital patient number 25617_KTD011.

[0215] Test results such as Figure 10 As shown, this sample is the capture result of RET-intron11.

[0216] 2. Sample 2: The source is the clinical sample of Yunnan Cancer Hospital patient number 25826_KTD031.

[0217] Test results such as Figure 11 As indicated, the sample was positive for the KRAS-G12D mutation.

[0218] 3. Sample 3: The source is the clinical sample of Yunnan Cancer Hospital patient number 24212_KTD044.

[0219] Test results such as Figure 12 As indicated, this sample was negative for the KRAS-G12D mutation.

[0220] 4. Sample 4: The source is the clinical sample of Yunnan Cancer Hospital patient number 27687_KTD060.

[0221] Test r...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of molecular biology, and particularly discloses a plasma free DNA lung cancer fusion gene combined detection primer group and kit. The kit provided by theinvention comprises: 1) a special linker for DNA library construction; 2) a specific composite primer for detecting fusion genes and point mutation; and 3) a composite primer for library amplification. According to the detection kit, DNA of a sample to be detected is extracted and subjected to fragmentation, terminal repair and linker connection, a product is subjected to PCR amplification, and high-throughput sequencing is performed after library enrichment. According to the fusion gene detection kit and detection method provided by the invention, various fusion genes or mutations related tolung cancer can be detected at one time, the detection efficiency is improved, the operation is convenient, the consumption time is short, and the sensitivity is relatively high and can reach 0.0625%.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a primer set and kit for joint detection of lung cancer-related gene fusion and / or mutation in plasma free DNA. Background technique [0002] At present, the morbidity and mortality of lung cancer rank first among all malignant tumors, and are widely divided into small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC), among which small cell lung cancer (SCLC) accounts for about 15%. , Non-small cell lung cancer (NSCLC) accounts for about 85%. According to the estimates of the World Health Organization, by 2025, the number of lung cancer deaths in my country will reach 1 million each year. Comprehensive treatment based on surgery, radiotherapy, chemotherapy and molecular targeted therapy is the most important treatment for lung cancer. Studies have shown that in the early stage of lung cancer, NSCLC has a good prognosis after surgical resection, and the 5...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12N15/11
CPCC12Q1/6886C12Q2600/156
Inventor 孙石磊姬云
Owner 苏州科贝生物技术有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More