Supercharge Your Innovation With Domain-Expert AI Agents!

Application of rice receptor protein-like coding gene OsRLP1 in resisting rice black-streaked dwarf virus

A technology of rice black bar dwarfing and receptor-like proteins, which is applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve problems such as ambiguous functions, and achieve the goals of deepening understanding and knowledge, enriching molecular mechanisms, and enriching research directions Effect

Active Publication Date: 2021-01-29
NINGBO UNIV
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the role of members of the rice RLP gene family in plant immunity to viruses, especially rice black-streaked dwarf virus infection, remains unclear.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of rice receptor protein-like coding gene OsRLP1 in resisting rice black-streaked dwarf virus
  • Application of rice receptor protein-like coding gene OsRLP1 in resisting rice black-streaked dwarf virus
  • Application of rice receptor protein-like coding gene OsRLP1 in resisting rice black-streaked dwarf virus

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0046] Example 1: Changes in the expression of OsRLP1 gene induced by RBSDV after infecting rice

[0047] (1) Extraction of total RNA from rice plants and synthesis of first-strand cDNA sequences

[0048] Use TRIzol reagent to extract total RNA from rice that is healthy and carries RBSDV 30d and 60d, and use the reverse transcription kit FastKing RT Kit (With gDNase) (manufacturer: Tiangen Biochemical Technology (Beijing) Co., Ltd., item number: KR116)

[0049] The extracted RNA was reverse transcribed into cDNA.

[0050] (2) qRT-PCR verification analysis of the expression changes of OsRLP1 gene

[0051] Using the above cDNA samples, the rice UBQ gene was used as an internal reference. Quantitative primers used qRT-OsRLP1, and the relative expression of OsRLP1 was as follows: figure 1 As shown, the quantitative primer sequences are as follows:

[0052] qRT-OsRLP1-F ccctttgcttcaagtgcttc (SEQ ID No: 2);

[0053] qRT-OsRLP1-R aagagaatgcaggctccaga (SEQ ID No: 3);

[0054] UB...

example 2

[0057] Example 2: Construction of rice OsRLP1 plant expression vector

[0058] (1) Cloning of rice OsRLP1 gene

[0059] According to the sequence (SEQ ID No:1) of OsRLP1, primers OsRLP1-F and OsRLP1-R were designed, and the primer sequences were as follows:

[0060] OsRLP1-F atgtccgtgatgagaggaag (SEQ ID No: 6);

[0061] OsRLP1-R ttagttaccttccgtagtatat (SEQ ID No: 7);

[0062] PCR amplification system: a total volume of 50 μL, including 5 μL of 10×PCR buffer, 1.5 μL of upstream and downstream primers (10 μM), 5 μL of dNTP Mix (2.5 mM), 1 μL of cDNA template, 1 μL of Taq enzyme (5U / μL), ddH 2 O 35 μL.

[0063] PCR amplification program: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 3 min, 40 cycles; final extension at 72°C for 10 min.

[0064] The PCR product was recovered, connected to the pMD18-T vector (Takara Biological Company, Cat. No. D101A), cloned, and sent for testing to confirm that the pMD18-T...

example 3

[0070] Example 3 Rice Genetic Transformation

[0071] (1) Agrobacterium transformation and callus induction culture: Transform Agrobacterium tumefaciens GV3101 (manufacturer: Shanghai Weidi, article number: AC1003S) with the plasmid containing the target vector stored in a -80°C refrigerator, and use the following steps: take 1 μL of the plasmid and add Add to 50 μL of competent cells, mix well, add to the cold electrode cup at 4°C, use a voltage of 2200V for electric shock transformation, add 600 μL of non-resistant LB, shake at 28°C, 200rpm for 2-3 hours, and spread on On a Rif plate containing 50 μg / ml Kan and 50 μg / ml, culture in an incubator at 28°C for 3 days. Dehull mature rice seeds, soak in 75% alcohol for 5min, ddH 2 O rinse several times, soak in 30% sodium hypochlorite solution for 30min, ddH 2 O Soak for 30min. Use tweezers to put the seeds into the induction medium, and place them in a light incubator at 28°C for 3 weeks. Clamp the grown callus into the subcul...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a rice receptor protein-like coding gene OsRLP1 and application thereof in resisting rice black-streaked dwarf virus, comprising the following steps of: overexpressing the plant rice receptor protein-like coding gene OsRLP1 to obtain a stably inherited transgenic plant, wherein experiments prove that after overexpression of the OsRLP1 gene, the resistance of the rice to the rice black-streaked dwarf virus can be enhanced, specifically, compared with a control group, after virus inoculation, the obtained transgenic plant has the advantages that the morbidity symptom isrelieved, the morbidity is reduced, the virus content is reduced, the research provides precious technical support for the action mechanism of members of the rice RLP gene family in plant disease-resistant breeding, especially in rice black-streaked dwarf virus infection.

Description

technical field [0001] The invention relates to the field of transgenic technology and the field of plant disease prevention and control, in particular to the rice receptor protein OsRLP1 gene and its application in rice black-streaked dwarf virus resistance and plant breeding. Background technique [0002] Rice black-streaked dwarf virus (RBSDV) is a rice virus that seriously endangers the yield and quality of rice. The virus is an icosahedral spherical structure with a diameter of 75-80nm. Undergraduate plants. Infected plants show severe stunting and white, waxy or wart-like protrusions on the underside of leaves, severely affecting the yield of commercial crops rice, corn, wheat and barley. In the late 1990s, the disease broke out in areas such as Jiangsu, Zhejiang, and the like. In rice fields with severe disease, the occurrence of the disease exceeded 90%, causing serious economic losses (Wang Huadi, etc., the prevalence of rice black-streaked dwarf Key technologies ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12N15/84A01H4/00A01H5/00A01H6/46
CPCC07K14/415C12N15/8283A01H4/001A01H4/008
Inventor 孙宗涛张合红马强王峰敏魏中艳陈剑平
Owner NINGBO UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com