Unlock instant, AI-driven research and patent intelligence for your innovation.

Protein interaction detection method based on split-hrv 3C protease

A protein interaction and detection method technology, which is applied in the field of protein interaction detection based on split-HRV3C protease, can solve problems such as false positive interactions, and achieve the effects of simple operation, good sensitivity, and improved sensitivity

Active Publication Date: 2022-08-09
HUBEI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At the same time, the use of immune labels in Co-IP will cause false positive interactions, and GST pull down requires the expression of purified proteins in vitro, which also has certain limitations.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Protein interaction detection method based on split-hrv 3C protease
  • Protein interaction detection method based on split-hrv 3C protease
  • Protein interaction detection method based on split-hrv 3C protease

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] The construction process of the vectors SPEC-VA and SPEC-VB for expressing HRV 3C protease substrate polypeptide and wild-type HRV 3C protease respectively, and the comparison of the working effects of wild-type HRV 3C protease and wild-type TEV protease

[0037] (1) First, two target genes, sfGFP-LEVLFQGP-SsrA and HRV 3C protease, were obtained by polymerase chain reaction (PCR) amplification. The reaction system was as follows: 50 μL system, 10×KOD buffer, 5 μL; dNTP (2.5 mM), 3μL; forward primer (10μM), 2μL; reverse primer (10μM), 2μL; Pfu high temperature DNA polymerase, 1μL; template (containing sfGFP-LEVLFQGP-SsrA sequence), 0.5μL (20ng / μL); water to 50 μL.

[0038] PCR amplification conditions: 95℃, 5min; 95℃, 30s, 57℃, 30s, 72℃, 30s, 25 cycles; 72℃, 5min; 12℃, 10min.

[0039] Primers were designed as follows:

[0040] T7-FP: GCCTGGTGCCGCGCGGCAGCCATATGATGGTGAGCAAGGGCGAG

[0041] T7-RP: CTTGTCGACGGAGCTCGAATTCGGATCCGGCTGCCAAAGCATAGTTTTC

[0042] 1928-HRV3C-Fwd:...

Embodiment 2

[0051] Construction process of split-HRV 3C protease vector with different split positions and comparison of the working effects of split-HRV 3C protease and split-TEV protease at different temperature ranges

[0052] Analyze the three-dimensional structure of HRV 3C protease, find three possible split sites (K92, L94, N107), which are located behind the random helix and β-pleated sheet respectively, and then construct K92 respectively according to the vector construction method in Example 1, L94, N107 split-HRV 3C protease vector with three split positions; the selected target protein pairs are Cas1 / Cas2-3 from Zymomonas mobilis and Yae1 / Lto1 from Saccharomyces cerevisiae.

[0053] Primers were designed as follows:

[0054] NC-FP1: GATTACGCCAAGCTTGCATGCCTGCAGTTGACAATTAATCATCGGCTCG

[0055] NC-RP1: CATACATCGTCCCAAGTATTCGACATGAATTCAATCTATGGTCCTTG

[0056] NC-FP2: CAAGGACCATAGATTGAATTCATGTCGAATACTTGGGACGATGTATGGGC

[0057] NC-RP2:GCTCCCGCCGCCACCACTACCACCGCCTCCTTGGATAGATGGCACA...

Embodiment 3

[0081] Construction process of BL21(DE3)-SPEC recombinant strain

[0082] In order to simplify the operation of the SPEC system and increase the stability of the SPEC system, the CRISPR / Cas9 coupled λ-red recombination technology was used to integrate the sfGFP-LEVLFQGP-SsrA substrate fragment into the E. coli BL21(DE3) chromosome. During the integration process, it is necessary to construct a pKD46-cas9-gRNA thermosensitive vector and prepare the target fragment LpxM-L--sfGFP-LEVLFQGP-SsrA--LpxM-R.

[0083] Primers were designed as follows:

[0084] 1. Amplify cas9 and anneal to obtain gRNA

[0085] CAS9-F: GATATACCATGGATAAGAAATACTCAATAGGCTTAGATATCGGCAC

[0086] CAS9-R: CCATCACCTTCCTCTTCTTCTTGGGGTCACCTCCTAGCTGACTCA

[0087] gRNA1:CGTCTGCATGCGAGAAAATGA

[0088] gRNA3: CAGCATGGCAGGAATATCGA

[0089] 2. Amplify LpxM-L-sfGFP, sfGFP-LEVLFQGP-SsrA and SsrA--LpxM-R, and then fuse and amplify to obtain a complete target fragment LpxM-L--sfGFP-LEVLFQGP-SsrA--LpxM-R

[0090] LSR-1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a protein interaction detection method based on split-HRV 3C protease-E.coli ClpXP system, the principle is as follows: due to the existence of ClpXP-SsrA degradation pathway, fusion protein of sfGFP-HRV 3C protease substrate polypeptide-SsrA is fused Recognized by the E. coli ClpXP complex, resulting in the degradation of sfGFP and low-intensity green fluorescence. The prey and bait proteins are fused to the N-terminal and C-terminal domains of the split-HRV 3C protease, respectively. When the prey and bait proteins interact, the N- and C-terminal HRV 3C proteases are fused to form a fully functional HRV 3C protease cleaves and recognizes the corresponding substrate polypeptide, resulting in the accumulation of sfGFP and the increase in fluorescence intensity. By integrating the ClpXP-SsrA degradation machine, sfGFP and split-HRV 3C protease, the invention can efficiently and sensitively detect protein-protein interaction in a wide temperature range according to the intensity of green fluorescence.

Description

technical field [0001] The invention relates to the field of protein interaction research, in particular to a protein interaction detection method based on split-HRV 3C protease. Background technique [0002] The study of protein interactions is of vital biological significance for understanding the metabolic processes in organisms and the protein functions involved. Nowadays, many methods for studying protein interactions have been developed, such as: bacteria / yeast two-hybrid technique, co-immunoprecipitation technique (Co-IP), GST pull down technique, split-protein complementation technique and so on. The characteristics of yeast two-hybrid technology are sensitive, efficient, easy to operate and can be verified on a large scale. In practical applications, due to the sensitivity of yeast two-hybrid technology, there are certain false positives. At the same time, because the reaction occurs in the nucleus, it is also Not for all proteins. At the same time, the use of imm...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/10C12N15/70C12Q1/37G01N15/14
CPCC12N15/1055C12N15/70C12Q1/37G01N15/14G01N2333/9513Y02A50/30
Inventor 易犁汪声晨张发英云月利张桂敏
Owner HUBEI UNIV