Supercharge Your Innovation With Domain-Expert AI Agents!

Construction method and application of azoospermia mouse model

A method for constructing a mouse model, which is applied in the field of constructing a mouse model of azoospermia, and can solve the problems of unmentioned testicular phenotype, intellectual disability with microcephaly, delayed speech development, and aggressive behavior.

Active Publication Date: 2021-04-13
THE FIRST AFFILIATED HOSPITAL OF SUN YAT SEN UNIV +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In recent years, some scholars have reported that mutations in PUS7 can lead to intellectual disability with microcephaly, short stature, delayed speech development, and aggressive behavior, but no testis-related phenotypes have been mentioned in the literature reports

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method and application of azoospermia mouse model
  • Construction method and application of azoospermia mouse model
  • Construction method and application of azoospermia mouse model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Expression of Pus7 in various tissues and its expression pattern in testis

[0041] The lung, muscle, kidney, brain, liver, and testis of 90-day wild-type C57BL / 6J mice were extracted, and RNA was extracted respectively, and the expression level of Pus7 gene was detected by qPCR. figure 2 The results of A suggest that PUS7 is highly expressed in the testis. Obtain 2w, 3w, 4w, 5w, 6w, 7w, 8w wild-type mouse testis tissues, extract protein, and perform western blot detection. figure 2 The results of B show that the expression of PUS7 is higher in the testis of mice aged 2 and 3 weeks, and the expression of PUS7 is lower at the age of 4-8 weeks. Immunohistochemical staining of PUS7 was performed on paraffin sections of testes of 90-day-old wild-type mice. figure 2 The results in C showed that PUS7 was expressed in spermatogonia, pachytene spermatocytes, leptotene spermatocytes and Sertoli cells.

Embodiment 2

[0042] Example 2 Constructing a Pus7 Knockout Mouse Model (C57BL / 6)

[0043] In order to further clarify the role of PUS7 in testicular development, Guangzhou Saiye Biological Co., Ltd. was commissioned to construct a Pus7 knockout mouse model using CRISPR / Cas gene editing engineering.

[0044] Design gRNA, targeting exons 1 and 2 of Pus7 (such as image 3 ); the gRNA constructed in vitro (see Table 1 for the sequence of the gRNA) was injected into fertilized eggs to knock out the Pus7 gene.

[0045] Table 1 gRNA targeting sequence

[0046] Primer name Primer sequence (5'-3') Numbering gRNA1 TGGGTTCATTGTAATCGTAACAGG SEQ ID NO.1 gRNA2 CATGCGGGGCTTTTGATCACAGG SEQ ID NO.2

Embodiment 3

[0047] Embodiment 3 mouse genotype identification

[0048] Design primers to identify the mouse genotype obtained in Example 2, the primer design site is as follows image 3 , the primer sequences are shown in Table 2. Genotype identification of 10-day-old neonatal mice: A small amount of mouse tail tissue was obtained, and DNA was extracted using Mouse Direct PCR Kit (Bimake, B40015). PCR was performed using the HotStart enzyme PCR reaction system, and the HotStart enzyme PCR reaction system is shown in Table 3. Prepare 3% agarose gel for DNA electrophoresis, Figure 4 Electropherograms identified for mouse genotyping. from Figure 4 It can be seen that only the 930bp band is a wild-type mouse, only the 690bp band is a homozygous mouse, and the band containing both 690bp and 930bp is a heterozygous mouse.

[0049] Table 2 Primer sequences for genotype identification

[0050] Primer name Primer sequence (5'-3') Numbering Primer-F ATGGATCGGAGGTAAGGGCA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of animal models, in particular to a construction method and application of an azoospermia mouse model. According to the construction method of the azoospermia mouse model, a Pus7 gene on a mouse genome is knocked out. The important role of the Pus7 (Pseudouridine synthase 7) gene in the spermatogenesis process of mice is disclosed for the first time, male mice knocked out by the Pus7 have testicular dysplasia and azoospermia, and a mechanism of regulating testicular development by the Pus7 is expected to provide a new thought for research of male infertility mechanisms.

Description

technical field [0001] The invention relates to the field of animal models, in particular to a construction method and application of an azoospermia mouse model. Background technique [0002] Infertility is a common disease that seriously affects human health, and its incidence has been increasing year by year in recent years. Infertility refers to those who have not conceived for more than one year when the couple has a normal sexual life and does not take any contraceptive measures. According to World Health Organization (WHO) statistics, infertile couples in the world account for about 15% of married couples (see Zegers-Hochschild F, Adamson GD, de Mouzon J, et al. International Committee for Monitoring Assisted Reproductive Technology (I CMART ) and the World Health Organization (WHO) revised glossary of ART terminology, 2009.FertilSteril2009; 92:1520-4.), male infertility is the main or partial cause of 20-70% infertile couples (see literature Practice Committee of th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/89C12N15/61A01K67/027
CPCC12N15/89C12N9/90A01K67/0276C12Y504/99A01K2217/075A01K2227/105A01K2267/03
Inventor 苏培强徐彩霞廖智恒周太峰杨晓明陈宇煜张舜吴金娜
Owner THE FIRST AFFILIATED HOSPITAL OF SUN YAT SEN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More