Gene YWL1 for controlling rice leaf color at low temperature and application of gene YWL1

A technology of leaf color and gene, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problem of unclear nuclear-cytoplasmic interaction mechanism

Inactive Publication Date: 2015-05-06
CHINA NAT RICE RES INST
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, the key enzymes in Arabidopsis chlorophyll synthesis have been identified (Nagata N(2005) Identification of a Viny Reductase Gene for Chlorophyll Synthesis in Arabidopsis thaliana and Implications for the Evolution of Prochlorococcus Species. The Plant Cell Online 17 :233-240), but only a few genes have been identified in rice, and other genes have yet to be further discovered
In addition, the regulatory mechanism of chlorophyll degradation is not yet clear, and the mechanism of nucleoplasmic interaction is still unclear, which needs to be further studied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene YWL1 for controlling rice leaf color at low temperature and application of gene YWL1
  • Gene YWL1 for controlling rice leaf color at low temperature and application of gene YWL1
  • Gene YWL1 for controlling rice leaf color at low temperature and application of gene YWL1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1: YWL1 map-based cloning

[0039] a) Rice material

[0040] Rice (Oryza sativa L) mutant ywl1 , the original wild-type material was indica rice variety 93-11.

[0041] b) Determination of chlorophyll content and photosynthetic characteristics

[0042] Soak the plump mutant and wild-type seeds to accelerate germination, sow the germinated mutant and 93-11 seeds in a pot, and place them in an artificial climate box at 23°C, 25°C, and 28°C, with 12 hours of light and 12 hours of dark treatment. cultivated in. Observe and record mutant phenotypes. The chlorophyll content of the leaves was measured at the first, second, third, fourth and fifth leaf stages.

[0043] Determination of chlorophyll content: Soak 0.1g-0.2g of the sample to be tested in 10ml of 95% ethanol, and place it in a refrigerator at 4°C to extract the pigment for about 48 hours. Measure the OD value under 665nm, 649nm, 470nm wave light with a type spectrophotometer. The contents of chl...

Embodiment 2

[0068] Embodiment 2: transgenic experiment

[0069] Plant Transformation:

[0070] 1. Vector Construction

[0071] Design a pair to completely cover the entire YWL1 Gene ORF primers, and 15 bases on both sides of the vector pCUbi1390 restriction site BamHI were added to the primers, the wild-type genomic DNA was amplified by PCR, and electrophoresis was used to detect and recover by gel cutting. The recombinant kit (Clontech, In-Fusion HD Enzyme) was connected to the pCUbi1390 vector linearized by BamHI digestion of the stem, and after being confirmed by sequencing, it was transformed into Agrobacterium ( A grobacterium tumefaciens ) in the EHA105 strain.

[0072] The primer sequence for amplifying the ORF sequence is:

[0073] RGg5F:GCAGGTCGAC GGATCC TATCCGATAACCGATAAAC (SEQ ID NO. 27)

[0074] RGg5R: GAATTCCCGG GGATCC CATAAGCAGGTTTGAGAAG (SEQ ID NO. 28)

[0075] 2. Genetic transformation:

[0076] (1) Selection of transformed receptors

[0077] will mutant y...

Embodiment 3

[0080] Example 3: YWL1 Chloroplast positioning experiment of (SEQ ID NO.2)

[0081] according to YWL1 The CDS sequence (SEQ ID NO.2) designed primers containing XholI and SalI restriction sites, and its sequence is:

[0082] PGXhF: TTT ctcgag ATAAACCCCTCCCCCACTCTCCAC (SEQ ID NO. 29)

[0083] PGSalR: TTT gtcgag CCAAATTTGATATTGCACAATGGGA (SEQ ID NO. 30)

[0084] Using wild-type cDNA as a template, amplified with high-fidelity enzymes YWL1 The CDS sequence of the gene (removing the stop codon), the amplified product was sequenced and verified to be correct, and then ligated with the PAN580-GFP vector to obtain the fusion expression vector 35S::YWL1:GFP.

[0085] Extract and construct the fusion expression vector 35S::YWL1:GFP plasmid and 35S::GFP without gene fusion to transform rice protoplast cells by PEG-mediated method. The rice protoplast cells after bombardment were cultured in the hypertonic medium for 16 hours in the dark, and then observed under a fluor...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of genetic engineering, and relates to a gene YWL1 for controlling rice leaf color at a low temperature and an application of the gene YWL1. The gene is used for encoding pseudouridine synthase; a dominant allele sequence of the gene is a nucleotide sequence shown in SEQ ID NO.1; the rice leaf is maintained normally green at the low temperature; a DNA sequence of a mutant gene of the gene is as shown in SEQ ID NO.4; and the rice leaf color at the low temperature is displayed into white stripes by the mutant gene. The low-temperature white stripe character displayed by the YWL1 gene mutant provided by the invention can be applied to cross breeding and elite breeding as the marker character; the seed purity can be measured; and false hybrids can also be eliminated at the seedling stage.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering. Specifically, the present invention relates to a method of cloning the rice YWL1 gene by map-based cloning technology, identifying the function of the gene by transgenic experiments, and the application of the gene in hybrid breeding and breeding of fine varieties. Background technique [0002] Leaf is the main organ for photosynthesis in plants, and more than 2 / 3 of the dry matter in rice grains is obtained through photosynthesis after flowering (Wang Xujun, Xu Qingguo, Yang Zhijian (2005) Research progress in rice leaf senescence physiology. China Agricultural Science Bulletin 21: 187-190), the efficiency of photosynthesis has a complex relationship with the integrity of chloroplast structure and function, the stability of photosynthetic complex, and the level of chlorophyll content. In recent years, the application value of leaf color has attracted much attention. Leaf color variation...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/60C12N9/88A01H5/00
Inventor魏祥进胡培松唐绍清刘聪利邵高能圣忠华焦桂爱谢黎虹
OwnerCHINA NAT RICE RES INST