Protein for regulation and control of leaf color at low temperature and its gene and application

A leaf color and protein technology, applied in the field of genetic engineering, can solve problems such as unclear nuclear-plasma interaction mechanism

Active Publication Date: 2014-01-08
CHINA NAT RICE RES INST
View PDF2 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, the key enzymes in Arabidopsis chlorophyll synthesis have been identified (Nagata N (2005) Identification of a Vinyl Reductase Gene for Chlorophy11 Synthesis in Arabidopsis thabliana and Implications for the Evolution of Prochlorococcus Species. The Plant Cell Online 17 :233-240 ), but only a few genes have been identified in rice, and other genes have yet to be further discovered
In addition, the regulatory mechanism of chlorophyll degradation is not yet clear, and the mechanism of nucleoplasmic interaction is still unclear, which needs to be further studied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Protein for regulation and control of leaf color at low temperature and its gene and application
  • Protein for regulation and control of leaf color at low temperature and its gene and application
  • Protein for regulation and control of leaf color at low temperature and its gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1: Phenotypic analysis of ywl1 mutants

[0037] a) Rice material

[0038] Rice (Oryza sativa L) mutant ywl1, the original wild-type material is indica variety 93-11.

[0039] b) Determination of chlorophyll content and photosynthetic characteristics

[0040] Select plump mutant and wild-type seeds to soak and accelerate germination, plant the germinated mutant and wild-type 93-11 seeds in pots, and set the daily constant temperature in the artificial climate box to 23°C, 25°C and 28°C respectively , the light length was 12h, the dark treatment was 12h, and the light intensity was 5Lax. Observe and record mutant phenotypes. The chlorophyll content of leaves was measured at five stages (one-leaf stage, two-leaf stage, three-leaf stage, four-leaf stage and five-leaf stage) before and after greening.

[0041] Determination of chlorophyll content: Take 0.1g-0.2g of the sample to be tested and soak it in 10ml of 95% ethanol, and place it in a refrigerator at 4°C t...

Embodiment 2

[0053] Embodiment 2: Cloning of YWL1 gene

[0054] a) Genetic analysis and mapping populations

[0055] The positive and negative hybridization was used to confirm that ywl1 was a recessive mutant, and the mutant was selected for hybridization with japonica rice 02428, the F1 generation was self-crossed, and a single plant was harvested to plant the F2 population, and 4391 recessive individuals were selected from the segregated population as the positioning population . At the three-leaf stage, about 1 gram of young leaves were taken from each plant to extract total DNA for gene mapping.

[0056] b) Preliminary and fine mapping of the YWL1 gene

[0057] Genomic DNA for gene localization was extracted from rice leaves using the rapid extraction method of rice micro-DNA. The DNA extraction method was SDS method (Dellaporta SL, Wood J, Hicks JB (1983) A plant DNA minipreparation: version Ⅱ. Plant Mol Bio Rep 1:19-21). Take about 100mg of rice leaves, cut them into pieces and ...

Embodiment 3

[0071] Example 3: Chloroplast localization experiment of YWL1 (SEQ ID NO.3)

[0072] According to the full-length CDS sequence of YWL1 (SEQ ID NO.2), a restriction recognition site containing BamHI was designed, and recombinant primers were designed. The sequence is:

[0073] PGXhF: TTTCTCGAGATAAACCCCCTCCCACTCTCCAC (SEQ ID NO. 14)

[0074] PGSalR: TTTGTCGAGCCAAATTTGATATTGCACAATGGGA (SEQ ID NO. 15)

[0075] Using the wild-type cDNA as a template, the CDS sequence (SEQ ID NO.2) of the YWL1 gene was amplified with PrimeSTAR high-fidelity enzyme. After the sequence was verified to be correct, the amplified product was ligated with the PAN580-GFP vector to obtain the fusion expression vector 35S ::YWL1::GFP.

[0076] Extract and construct the fusion expression vector 35S::YWL1::GFP plasmid and the 35S::GFP control plasmid without gene fusion respectively wrapped with gold powder, and use the PDS-1000 / He type gene gun of Bio-rad company under the helium pressure of 1100psi Bombar...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a protein for regulation and control of leaf color at low temperature and its gene and application, and belongs to the technical field of gene engineering. The invention discloses a gene nucleotide sequence and an amino acid sequence of the protein for regulation and control of the leaf color at low temperature, and provides the application of the gene. According to the gene, rice seedling stage temperature sensitive mutant is used, and cloned to YWL1 gene by using a map-based cloning method, and the gene is localized on chloroplast pseudouridine synthase family proteins. Functions of the YWL1 gene are identified by genetically modified (gm) complementary experiments. The gene can adjust the rice chloroplast development to obtain seedling stage leaf change phenotype and lay a foundation for the further use of the gene.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a protein for regulating the color of leaves at low temperature, its gene and application. Background technique [0002] Leaf is the main organ for photosynthesis in plants, and more than 2 / 3 of the dry matter in rice grains is obtained through photosynthesis after flowering (Wang Xujun, Xu Qingguo, Yang Zhijian (2005) Research progress in rice leaf senescence physiology, China Agricultural Science Bulletin 21: 187-190), the efficiency of photosynthesis has a complex relationship with the integrity of chloroplast structure and function, the stability of photosynthetic complex, and the level of chlorophyll content. In recent years, the application value of leaf color has attracted much attention. Leaf color variation can be used as a marker trait, which plays an important role in rice hybrid breeding and improved rice breeding. It can be used to determine ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C07K14/415C12N5/10C12N1/21C12N1/15C12N1/19C12N15/82
Inventor魏祥进胡培松唐绍清邵高能焦桂爱谢黎虹圣忠华宋建刘聪利
OwnerCHINA NAT RICE RES INST