Primer group for one-step visual detection of novel coronavirus nucleic acid and kit thereof

A coronavirus and detection reagent technology, which is applied in the field of novel coronavirus detection, can solve the problems of long detection time, complex operation process, and increased pollution risk, and achieve the effects of short detection time, low equipment requirements, and pollution avoidance

Active Publication Date: 2021-04-13
HUNAN TARGETING DETECTION TECH CO LTD
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Although loop-mediated isothermal amplification has many detection advantages, when it is combined with reverse transcription technology to detect RNA viruses (such as new coronaviruses), there are still technical defects such as long detection time, increased contamination risk, and complicated operation procedures, which lead to There are still some limitations in practical application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer group for one-step visual detection of novel coronavirus nucleic acid and kit thereof
  • Primer group for one-step visual detection of novel coronavirus nucleic acid and kit thereof
  • Primer group for one-step visual detection of novel coronavirus nucleic acid and kit thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0036] The method for preparing the primers is not particularly limited in the present invention, and conventional primer synthesis methods in the art can be used.

[0037]The present invention also provides a one-step visual detection kit for novel coronavirus, comprising the primer set and detection reagents, the detection reagents comprising enzyme detection mixture, guanidine hydrochloride and pH indicator; Includes Taq SSB.

[0038] In the present invention, the use concentrations of the F3, B3, FIP-1, BIP-1, FL-1 and BL-1 are preferably 1.5-2.5 μmol / L, 1.5-2.5 μmol / L, 15-17 μmol / L, respectively L, 15~17μmol / L, 0.3~0.5μmol / L and 0.3~0.5μmol / L, more preferably 1.8~2.2μmol / L, 1.8~2.2μmol / L, 15.5~16.5μmol / L, 15.5~16.5μmol / L, 0.35-0.45 μmol / L and 0.35-40.5 μmol / L, most preferably 2 μmol / L, 2 μmol / L, 16 μmol / L, 16 μmol / L, 0.4 μmol / L and 0.4 μmol / L. The present invention has no special limitation on the original concentration of the above-mentioned primers in the kit. When i...

Embodiment 1

[0059] Phenol Red-LAMP Visual Amplification Detection of Novel Coronavirus

[0060] 1. Primer design

[0061] A specific novel coronavirus loop-mediated isothermal amplification primer system was designed for the optimization of the N gene of the new coronavirus, and the primers were dissolved and diluted to the use concentration with nuclease-free ultrapure water. The primer sequences are as follows:

[0062] F3: ATTGAACCAGCTTGAGAGCA (SEQ ID No. 1);

[0063] B3: AATTTGCGGCCAATGTTTGT (SEQ ID No. 2);

[0064]FIP-1: TTGCCGAGGCTTCTTAGAAGCCAGGCCAACAACAAC AAGGC (SEQ ID No. 3);

[0065] BIP-1:AACACAAGCTTTCGGCAGACGTTGATTAGTTCCTGGT CCCCA (SEQ ID No. 4);

[0066] FL-1: AGCAGCAGATTTCTTAGTGACAGTT (SEQ ID No. 5);

[0067] BL-1: GGTCCAGAAACAAACCCAAGG (SEQ ID No. 6).

[0068] 2. Inspection process (such as figure 1 shown)

[0069] (1) Sample processing

[0070] Nasal / pharyngeal swab after sampling (nasal / pharyngeal swab is a nasal / pharyngeal swab dipped in pseudovirus solution) soa...

Embodiment 2

[0078] Detection of the effect of different concentrations of guanidine hydrochloride in the kit on the amplification efficiency

[0079] Construct and detect a 25 μL reaction system in a PCR reaction tube: 1 μL pseudovirus containing the N gene (20 copies / μL), 12.5 μL 2×enzyme detection mixture (40 mmol / L Tris-HCl, 20 mmol / L (NH 4 ) 2 SO 4 , 100mmol / LKCl, 16mmol / L MgSO 4 , 0.2% (v / v) Tween 20, 2.8mmol / L dNTP, 1.4mmol / L dUTP, 20U Bst2.0 WarmStart DNA Polymerase, 20U WarmStart RTx Reverse Transcriptase, 20U racilDNA Glycosylase, 3ng / μL Taq SSB, pH 8.8), 2.5 μL primer mixed solution (2 μmol / LF3 and B3, 16 μmol / LBIP-1 and FIP-1, 0.4 μmol / L FL-1 / BL-1); add 0, 10, 20, 30, 40, 50, 60 , 70 and 80 mmol / L guanidine hydrochloride (final concentration), 1 μL pH indicator (0.1% phenol red), supplemented with DEPC-H 2 O to a final volume of 25 μL / tube, centrifuge briefly, add 40 μL of mineral oil to each tube, and cap the tube tightly. Amplify in a constant temperature water bath or a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a primer group for one-step visual detection of novel coronavirus and a kit thereof, and belongs to the technical field of novel coronavirus detection, the primer group comprises F3, B3, FIP-1, BIP-1, FL-1 and BL-1; wherein the nucleotide sequences of the F3, the B3, the FIP-1, the BIP-1, the FL-1 and the BL-1 are respectively as shown in SEQ ID No. 1 to SEQ ID No. 6; the kit comprises the primer group and a detection reagent, and the detection reagent comprises an enzyme detection mixed solution, guanidine hydrochloride and a pH indicator; wherein the enzyme detection mixed solution comprises Taq SSB. In the detection process of the primer group and the kit, nucleic acid extraction is not needed, and detection can be performed by adopting a nasal/pharyngeal swab sample soaked in an inactivated virus preservation solution; after virus RNA amplification, the color of the reaction solution is changed, and the result can be judged through naked eye observation.

Description

technical field [0001] The invention belongs to the technical field of novel coronavirus detection, in particular to a primer set and a kit for one-step visual detection of novel coronavirus. Background technique [0002] The detection methods of the new coronavirus mainly include nucleic acid detection, antibody detection, and antigen detection. The detection rate of antigen detection is low; antibody detection is convenient and rapid, and can be used as a supplementary method for nucleic acid diagnosis. However, due to the limitations of antibody detection "false positive" and "false negative", it is not suitable for resumption of work, production and school, etc. General population screening is also not suitable for epidemiological investigations in low-endemic areas. Nucleic acid detection is currently the "gold standard" for the detection of new coronaviruses. It has the characteristics of early diagnosis, high sensitivity and specificity, and can detect patients in th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11
CPCC12Q1/701C12Q1/6844C12Q2531/119C12Q2527/125C12Q2537/1376Y02A50/30
Inventor 张何李石陈小洪刘祖源刘美慧杨梅綦梓伊
Owner HUNAN TARGETING DETECTION TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap