NLR signal path related to anti-avian pathogenic escherichia coli and application thereof

Pending Publication Date: 2021-04-30
YANGZHOU UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, breeding disease-resistant varieties through specific genes or pathways is a simple and effective method. However, there is no selection for resistance to avian pathogenic E. coli in poultry production, let alone the application of related genetic markers.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • NLR signal path related to anti-avian pathogenic escherichia coli and application thereof
  • NLR signal path related to anti-avian pathogenic escherichia coli and application thereof
  • NLR signal path related to anti-avian pathogenic escherichia coli and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0075] RNAseq transcriptome sequencing analysis of blood, spleen, bone marrow, thymus and bursa;

[0076] (1) Take 50mg of spleen, bursa of Fabricius, bone marrow and thymus, and 1ml of blood, and use the RNA extraction kit (AM1839) (Applied Biosystems, Foster City, CA) for total RNA extraction. The RNA quality, concentration, and integrity were detected by Agilent 2100 Bioanalyser (Agilent Technologies), and finally the OD260 / 280 ratio greater than 2.0 and the RIN value greater than 9.0 were selected as qualified for subsequent experiments.

[0077] (2) Prepare the cDNA library according to the instructions of the Illumina TruSeq® RNA Sample Preparation v2 kit. Illumina® HiSeq 2000 was used to perform high-throughput sequencing on the prepared cDNA library to obtain data.

[0078] (3) Sequencing data analysis. First, use the Fastx toolkit (version 0.0.13) software to filter low-quality bases (Sanger base quality < 20). The quality of the filtered sequences was detected by ...

Embodiment 2

[0081] Establishment of gene detection method for NLR signaling pathway;

[0082] (1) Amplify the corresponding nucleotide fragment with primers for the target fragment of the NLR pathway marker gene significantly related to resistance to avian pathogenic Escherichia coli, and the upstream and downstream primers for sequence amplification are:

[0083] Upstream primer NOD1-F: CTGTGTCCTGCAGAAAGT (SEQ ID NO.1)

[0084] Downstream primer NOD1-R: CCTGCTAACTGGATCTGTATT (SEQ ID NO.2)

[0085] Upstream primer RIPK2-R: TCGAACCAGTCCTGAGAACG (SEQ ID NO.3)

[0086] Downstream primer RIPK2-R: CGGATGTTTCCTCTTGGGGAT (SEQ ID NO.4)

[0087] Upstream primer CARD9-R: CAAGGCTAGCTGAGTCAAAG (SEQ ID NO.5)

[0088] Downstream primer CARD9-R: CTGTTGCAGCTCTTCCTAAA (SEQ ID NO.6)

[0089] Upstream primer MAPK3-R: GCTTTTCCCTACCACACAAA (SEQ ID NO.7)

[0090] Downstream primer MAPK3-R: CCAGATATGGATGGGCTAAAG (SEQ ID NO.8)

[0091] Upstream primer FOS-R: CCGCATGGAGTTTGTCTT (SEQ ID NO.9)

[0092] Downs...

Embodiment 3

[0120] Marker gene expression analysis;

[0121] A kind of marker gene for screening resistance to avian pathogenic Escherichia coli provided by the present invention, broiler chickens with high expression of NLR signaling pathway genes are resistant chickens, and broilers with low expression of NLR signaling pathway genes are susceptible chickens, such as image 3 Therefore, individuals with high expression of NLR signaling pathway genes were selected during the subculture selection process.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an anti-avian pathogenic escherichia coli related NLR signal path and application thereof, and provides an anti-avian pathogenic escherichia coli related genetic marker, which is an NLR signal path. The invention provides application of a reagent for detecting the genetic marker in preparation of a kit for identifying to-be-detected chicken anti-avian pathogenic escherichia coli. The invention further provides a kit for identifying anti-avian pathogenic escherichia coli, and a method for screening commercial broiler chicken with anti-avian pathogenic escherichia coli. By means of the invention, marker genes related to avian pathogenic escherichia coli are used for marker-assisted selection, so that the immunocompetence of poultry can be effectively improved; the sequence and the identification method of the NLR signal pathway gene are provided, and an efficient, accurate and rapid molecular marker assisted breeding technology can be established by utilizing a Sanger sequencing method through primers of the pathway gene, so that the immunity is improved, the breeding can be carried out in the early stage, the breeding cost is reduced, and the production benefit is improved.

Description

technical field [0001] The invention relates to an NLR signaling pathway related to resistance to avian pathogenic Escherichia coli and an application thereof, belonging to the field of biotechnology. Background technique [0002] The rapid development of intensive high-density poultry industry makes poultry production face more bacterial infections and inflammatory reactions. Avian pathogenic Escherichia coli (APEC) can cause severe respiratory diseases. As a primary or secondary immunogen, it forms avian colibacillosis through different pathogenic mechanisms, which can cause millions of dollars in losses every year, and has zoonotic potential for infection. At present, APEC strains are mostly drug-resistant and their vaccines only work on the same strains. Therefore, it is more effective and feasible to carry out genetic selection—screening varieties resistant to avian pathogenic Escherichia coli. However, genetic selection requires substantial costs for experiments suc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/158C12Q2600/124
Inventor孙红艳李欢左其生张亚妮李碧春
OwnerYANGZHOU UNIV