NLR signal path related to anti-avian pathogenic escherichia coli and application thereof
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0075] RNAseq transcriptome sequencing analysis of blood, spleen, bone marrow, thymus and bursa;
[0076] (1) Take 50mg of spleen, bursa of Fabricius, bone marrow and thymus, and 1ml of blood, and use the RNA extraction kit (AM1839) (Applied Biosystems, Foster City, CA) for total RNA extraction. The RNA quality, concentration, and integrity were detected by Agilent 2100 Bioanalyser (Agilent Technologies), and finally the OD260 / 280 ratio greater than 2.0 and the RIN value greater than 9.0 were selected as qualified for subsequent experiments.
[0077] (2) Prepare the cDNA library according to the instructions of the Illumina TruSeq® RNA Sample Preparation v2 kit. Illumina® HiSeq 2000 was used to perform high-throughput sequencing on the prepared cDNA library to obtain data.
[0078] (3) Sequencing data analysis. First, use the Fastx toolkit (version 0.0.13) software to filter low-quality bases (Sanger base quality < 20). The quality of the filtered sequences was detected by ...
Embodiment 2
[0081] Establishment of gene detection method for NLR signaling pathway;
[0082] (1) Amplify the corresponding nucleotide fragment with primers for the target fragment of the NLR pathway marker gene significantly related to resistance to avian pathogenic Escherichia coli, and the upstream and downstream primers for sequence amplification are:
[0083] Upstream primer NOD1-F: CTGTGTCCTGCAGAAAGT (SEQ ID NO.1)
[0084] Downstream primer NOD1-R: CCTGCTAACTGGATCTGTATT (SEQ ID NO.2)
[0085] Upstream primer RIPK2-R: TCGAACCAGTCCTGAGAACG (SEQ ID NO.3)
[0086] Downstream primer RIPK2-R: CGGATGTTTCCTCTTGGGGAT (SEQ ID NO.4)
[0087] Upstream primer CARD9-R: CAAGGCTAGCTGAGTCAAAG (SEQ ID NO.5)
[0088] Downstream primer CARD9-R: CTGTTGCAGCTCTTCCTAAA (SEQ ID NO.6)
[0089] Upstream primer MAPK3-R: GCTTTTCCCTACCACACAAA (SEQ ID NO.7)
[0090] Downstream primer MAPK3-R: CCAGATATGGATGGGCTAAAG (SEQ ID NO.8)
[0091] Upstream primer FOS-R: CCGCATGGAGTTTGTCTT (SEQ ID NO.9)
[0092] Downs...
Embodiment 3
[0120] Marker gene expression analysis;
[0121] A kind of marker gene for screening resistance to avian pathogenic Escherichia coli provided by the present invention, broiler chickens with high expression of NLR signaling pathway genes are resistant chickens, and broilers with low expression of NLR signaling pathway genes are susceptible chickens, such as image 3 Therefore, individuals with high expression of NLR signaling pathway genes were selected during the subculture selection process.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap