Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Antigen-binding fragment of anti-bcma and application thereof

A technology combining fragments and BCMA-55, applied in the field of biomedicine, can solve the problems of high effective drug clearance rate, failure to solve the recurrence rate of patients, etc., and achieve the effect of improving the killing ability

Active Publication Date: 2022-07-29
HUADAO SHANGHAI BIOPHARMA CO LTD
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Although traditional treatment methods such as protease inhibitors (PI) and immunomodulators (IMID) have shown good curative effects, they still have not solved the problems of high relapse rate and low drug clearance rate.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antigen-binding fragment of anti-bcma and application thereof
  • Antigen-binding fragment of anti-bcma and application thereof
  • Antigen-binding fragment of anti-bcma and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] This example is used for the construction and panning of phage nanobody library, and ELISA is used for preliminary screening. Specific steps are as follows:

[0063] (1) Construction of phage nanobody library

[0064] Bactrian camels were immunized with BCMA-Fc expressing the extracellular region, and after ELISA was used to verify the titer, 200 mL of peripheral blood was drawn; lymphocytes were sorted to obtain peripheral blood mononuclear lymphocyte precipitates, and RNA was extracted; III reverse transcriptase uses RNA as a template to synthesize the first-strand cDNA, and then uses nested PCR to amplify the VHH gene; insert the VHH gene into the pMECS phage display vector, and electrotransform TG1 competent cells, and take an appropriate amount of bacterial liquid for library identification , all the remaining cultures were evenly spread on the LB / AMPGLU plate. After the bacteria grew out, the bacterial lawn was collected, and 1 / 3 volume of 50% glycerol was added...

Embodiment 2

[0078] In this example, the candidate clones were screened by flow cytometry (Fluorescence activated CellSorting, FACS).

[0079] Cells were cultured according to standard cell culture protocols, and cells were digested with trypsin to prepare BCMA-positive and negative cell suspensions; centrifuged at 300 g for 5 min to remove the culture medium, and resuspended cells in Flow Buffer to 2×10 6 cells / mL; add 2 x 10 to each well in a V-bottom 96-well plate 5 Cells were centrifuged at 300g for 5min, the supernatant was removed, the crude VHH antibody extract was added to resuspend the cells, and the cells were incubated at 4°C for 1h;

[0080]After centrifugation at 300 g for 5 min, remove the supernatant, resuspend the cells in Flow Buffer, dilute APCanti-his antibody to 2 μg / mL in Flow Buffer, resuspend cells in 100 μL per well, and incubate at 4°C for 1 h; wash the cells with Flow Buffer for 3 times and then use 200 μL Flow Buffer Cells were resuspended and analyzed by flow c...

Embodiment 3

[0082] In this example, the VHH-mIgG2a Fc nanobody was expressed and purified, and the antibody affinity was determined. In order to further identify the antibodies obtained by screening, the antibodies need to be expressed by mammalian cells. Therefore, a plasmid vector expressing VHH with a mouse Fc tag was constructed first, which is denoted as C-4pCP.Stuffer-mCg2a-FC. The specific steps are as follows:

[0083] 1. Amplify BCMA VHH B55 by PCR with primers:

[0084] HD-F (SEQ ID NO. 10):

[0085] CGCGATTCTTAAGGGTGTCCAGTGCGAGGTTGCAGCTGGTGGA;

[0086] HD-B55-R (SEQ ID NO. 11):

[0087] GCATGGAGGACAGGGCTTGATTGTGGGAGAAGACACTGTCACCTG

[0088] The reaction system is shown in Table 2, and the amplification procedure is shown in Table 3 below:

[0089] Table 2

[0090]

[0091] table 3

[0092]

[0093] 2. The digestion system is shown in Table 4. The digestion temperature is 37°C and the time is 6h. The PCR purification kit was used for purification, and the recovere...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides an anti-BCMA antigen-binding fragment and its application. The heavy chain variable region of the antigen-binding fragment of the anti-B cell mature antigen includes: the complementarity determining region 1 shown in SEQ ID NO.1, the complementarity determining region 2 shown in SEQ ID NO.2 and the complementarity determining region shown in SEQ ID NO.3. Complementarity determining region 3 shown. In the present invention, the antibody screened by the phage display antigen-binding fragment library has a specific CDR region, and the obtained antibody can specifically bind to the BCMA antigen, and has good affinity, and its K a (1 / Ms) is 2.81E+06, K d (1 / s) is 4.36E‑04, K D (M) is 1.55E-10; it is used as an antigen-binding domain to construct chimeric antigen receptors and CAR-T cells, which has broad application prospects in the immunotherapy of multiple myeloma.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and particularly relates to an antigen-binding fragment of an anti-B cell mature antigen and an application thereof. Background technique [0002] Multiple myeloma (MM) is a malignant tumor of plasma cells, the second most common tumor in the blood system, and there is still no cure. Monoclonal proliferation of plasma cells in the bone marrow and secretion of monoclonal immunoglobulin or its fragment (myeloma protein, M protein) are its main features; common clinical manifestations are bone pain, anemia, renal insufficiency and infection. [0003] Although traditional treatment methods such as protease inhibitors (PIs) and immunomodulators (IMIDs) have shown good efficacy, they still do not solve the problems of high recurrence rate and low effective drug clearance rate. Patients with relapsed and refractory multiple myeloma (RRMM) in whom neither PIs nor IMIDs are refractory survive for onl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K16/28C12N15/13C07K19/00C12N15/867C12N5/10A61K39/00A61P35/00
CPCC07K16/2878C07K14/7051C07K14/70517C07K14/70578C12N5/0636C12N15/86A61K39/001117A61P35/00C07K2317/565C07K2317/56C07K2317/567C07K2317/569C07K2319/02C07K2319/03C07K2319/33C07K2319/74C12N2740/15043C12N2800/107C12N2510/00A61K2039/5156A61K2039/804
Inventor 余学军狄升蒙侯莉何薇潘傅晶
Owner HUADAO SHANGHAI BIOPHARMA CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com