Asparagus U6 gene promoter AspU6p3 and cloning and application thereof
A 35s-aspu6p3-hyg, 35s-aspu6p3-kana technology, applied in the field of genetic engineering, can solve the problems of limited application, lack, lack of research on U6 promoter, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] Acquisition of U6 Gene Promoter AspU6P3 in Asparagus
[0047] (1) According to the conservation of the U6 gene sequence among different species, use the DNA sequence of the conserved 102bp U6 snRNA of the Arabidopsis thaliana sequence AtU6-26 gene (Genebank accession number: X52528.1) as a reference to search the asparagus genome database (https : / / www.ncbi.nlm.nih.gov / genome / ?term=asparagus), it was found that the asparagus genome contains multiple copies of the U6 gene, and E_Valu>4e was selected -40 The 6 predicted asparagus U6 coding genes were analyzed for transcriptional essential elements of their upstream 1000bp sequences using the Plant CARE online analysis software. The analysis results found that the cis-elements TATA-box and CAAT-box related to basic transcription and enhanced transcription were mainly concentrated within 600 bp upstream of the transcription initiation site of these U6 genes, and were screened from these asparagus U6 promoters. Two promoter...
Embodiment 2
[0056] Construction of asparagus gene editing vector
[0057] (1) AspU6P3 was constructed on gene knockout vectors 35S-ATU6-Hyg and 35S-ATU6-Kana
[0058] The 35S-ATU6-Hyg and 35S-ATU6-Kana vectors were digested with Hind III-HF and XbaI, the Arabidopsis U6 promoter on the vectors was removed, and the 14554bp and 14323bp vector backbone fragments were recovered respectively.
[0059] Primers with homology arms designed for homologous recombination cloning:
[0060] AspU6P3-F: gacggccagtgccaagctt CAGAGCTGTCAAAAACGACTTCG;
[0061] AspU6P3-R: aaaacagagaccgtctagatggtctc GACGTGAGATAGCAAAAGCAAG (the underlined sequence is homologous to the 35S-ATU6-Hyg and 35S-ATU6-Kana vectors).
[0062] Utilize the primer AspU6P3-F / R containing the homology arm, use the AspU6P3 fragment as the template, PCR amplify the AspU6P3 promoter DNA fragment containing the homology arm at both ends, use The recombinase homologously recombined the above fragments into the linearized 35S-ATU6-Hyg and ...
Embodiment 3
[0070] Obtaining gene-edited plants of asparagus and detection of target sequence mutation sites
[0071] (1) In this example, the embryogenic callus of 'JKT4' was transformed with Agrobacterium EHA105-mediated editing vectors 35S-AspU6P3-Hyg-aspIPA1-T2 and 35S-AspU6P3-Kana-aspIPA1-T2. The 35S-AspU6P3-Hyg-aspIPA1-T2 and 35S-AspU6P3-Kana-aspIPA1-T2 vectors were respectively transformed into Agrobacterium EHA105 by freeze-thawing method, and the concentration of the bacteria solution was adjusted to OD600=0.5, and the induction of 2,4-D+KT The embryogenic callus of 'JKT4' was infected, co-cultured for 3 days and cultured in a selection medium containing 50.0 mg / L hygromycin for one month to obtain positive callus, and seedlings were grown on MS medium to obtain plants .
[0072] (2) Detection of target sequence mutation sites in asparagus aspIPA1 plants
[0073] Extraction of Asparagus Gene Knockout T by CTAB Method 0 Genomic DNA of the first generation transgenic plants, fir...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap