Recombinant strain for modifying corynebacterium glutamicum promoter, construction method of recombinant strain and application of recombinant strain in production of L-amino acid

A technology of Corynebacterium glutamicum and promoter, applied in the fields of genetic engineering and microorganisms, can solve problems such as product accumulation, and achieve the effect of increasing yield

Active Publication Date: 2021-06-18
SHENZHEN INST OF ADVANCED TECH CHINESE ACAD OF SCI +1
View PDF7 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Existing technologies and methods are all overexpression or multi-copy key enzyme genes in the lysine metabolism pathway in Corynebacterium glutamicum, but in fact due to the complexity of metabolic pathway regulation, the products and precursor substrates in the pathway There are mutual synergies or feedback inhibition, etc., and it is not that the stronger the promoter used to overexpress the key enzyme gene, the more the product accumulates
In addition, currently some promoters in Corynebacterium have not been specifically used in the L-lysine production pathway of Corynebacterium glutamicum, and suitable promoters that can increase product yield need further verification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant strain for modifying corynebacterium glutamicum promoter, construction method of recombinant strain and application of recombinant strain in production of L-amino acid
  • Recombinant strain for modifying corynebacterium glutamicum promoter, construction method of recombinant strain and application of recombinant strain in production of L-amino acid
  • Recombinant strain for modifying corynebacterium glutamicum promoter, construction method of recombinant strain and application of recombinant strain in production of L-amino acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Embodiment 1 constructs the pEC-H10-mCherry plasmid that strong promoter H10 promotes the expression of mCherry in Corynebacterium glutamicum

[0052]The strongest promoter H10 in Corynebacterium glutamicum reported by Wei et al. (SEQ ID NO:11, GCTAACCCTTACCGGTCGGCTCTAAGCCGGCGGCGTATGGTAAGCTCTGTTATGTATA GTCCGAGCACGGCGAAAGGATACTC) as a template, and the gene sequence of mCherry protein and the sequence of expression vector pEC-XK99E in Corynebacterium glutamicum, designed and synthesized primers for the construction of pEC-H10-mCherry vector. The primers were designed as follows (synthesized by Guangzhou Jinweizhi Co.):

[0053]

[0054] Construction method: using pEC-XK99E as a template, using primers 1 (SEQ ID NO:1) and 2 (SEQ ID NO:2) to amplify the backbone region (6743bp) of the pEC plasmid, and using primer 3 (SEQ ID NO:3) and 4 (SEQ ID NO:4) amplify the fragment (387bp) containing the upstream region of the H10 promoter; with the plasmid pBblactam containing th...

Embodiment 2

[0055] Example 2 Constructing a Saturation Mutation Library of Strong Promoter H10

[0056] Using the pEC-H10-mCherry plasmid as a template, the non-conserved region (NNAGGANNNNN) of the RBS binding site in the H10 promoter region and the 5 base regions upstream were designed and synthesized for the saturation mutation library primers. The primers were designed as follows (Guangzhou Golden Synthesized by Weizhi Company):

[0057]

[0058] Construction method: using the pEC-H10-mCherry plasmid as a template, primers 3 and 7 (SEQ ID NO: 7) amplified the fragment containing the saturation mutation in the upstream region of the H10 promoter, and primers 8 (SEQ ID NO: 8) and 6 amplified To increase the saturation mutation fragment containing the RBS binding site, the PCR reaction system is: 0.5 μl template DNA, 0.25 μl each primer (100 pmol), 25 μl pfu (Novazyme 2×Phanta Master mix), dH 2 O 24 μl, total volume 50 μl. The PCR amplification was carried out as follows: 95°C pre-d...

Embodiment 3

[0059] Example 3 Screening for a more active promoter from the H10 promoter mutation library

[0060] From the H10 promoter mutation library in Corynebacterium glutamicum obtained in Example 2, randomly select clones to contain 96 deep-well plates of 900 μl LBHIS medium, and select 5 96 deep-well plates altogether, wherein each 96 Each deep well plate contains 3 unmutated H10 promoter strains. After cultured at 30°C and 800rpm for 24 hours, use a microplate reader to detect the fluorescence value of mCherry, and screen out the promoter with stronger activity than the H10 promoter according to the fluorescence intensity. , named the stronger promoter that was screened out as EPH16, and sequenced it. The sequence was (SEQ ID NO: 9): GCTCAgctttTACCGGTCGGCTCTAAGCCGGCGGCGTATGGTAAGCTCTGTTATGTATAGTCCGAGCACGGCGAAAGGATGAAT.

[0061] Each promoter of H10, EPH16 and pdapA was used as a reporter protein with mCherry, and the vector was constructed based on the pEC plasmid; the competent s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for carrying out saturated mutation on known promoters to screen a large number of promoter mutants with different starting activity intensities, and adding modified promoters in front of genes related to amino acid synthesis pathways in industrial amino acid-producing strains to screen strains with further improved amino acid yield, and a mutant promoter sequence obtained from the method and a recombinant strain obtained from the method.

Description

technical field [0001] The invention belongs to the technical fields of genetic engineering and microorganisms, and in particular relates to a recombinant bacterial strain producing L-amino acid and its construction method and application. Background technique [0002] Among the industrialized production methods of L-amino acid, the fermentation method is one of the most widely used methods at present. Improvements to the fermentative production of L-amino acids may relate to fermentation techniques such as agitation and supply of oxygen; or to the composition of the nutrient medium, such as sugar concentration during fermentation; or to processing the fermentation broth into a suitable product form, such as by drying and pelleted fermentation broth or ion-exchange chromatography; or may involve inherent performance properties of the relevant microorganism itself. [0003] Methods for improving the performance properties of these microorganisms include mutagenesis, selectio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/77C12N15/65C12N1/21C12P13/04C12R1/15
CPCC12N15/77C12N15/65C12P13/04C12N2830/34
Inventor罗小舟赵西西冯庭叶孟刚魏爱英赵春光
OwnerSHENZHEN INST OF ADVANCED TECH CHINESE ACAD OF SCI