Non-viral vector based on DNAzyme catalytic oligopeptide covalent assembly as well as preparation method and application of non-viral vector
A non-viral vector, short peptide technology, used in recombinant DNA technology, other methods of inserting foreign genetic materials, pharmaceutical formulations, etc., can solve problems such as instability of organic compounds
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] A method for preparing a non-viral vector based on DNAzyme catalyzed covalent assembly of short peptides, the preparation method comprising the following steps:
[0044](1) Heat an appropriate amount of nucleic acid rich in G base sequence to 90°C one week in advance, take it out after 10 minutes, cool it to room temperature, and then store it in the upper layer of the refrigerator at a temperature of 4-10°C, waiting for the formation of the G4 structure; The gene sequence of the nucleic acid rich in G base sequence is: 3'-TTGGGTTGGGTTGGGTTGGGTTTT CAGCGTGCGCCATCCTTCCCATCCTCCTCC -5', the underlined part is the ASO sequence that can reduce the expression of the anti-apoptotic protein Bcl-2, if it is replaced with a nucleic acid sequence that can treat other diseases, the targeted treatment of other diseases can also be achieved;
[0045] (2) Add 50uL 2μM hemin solution to 50uL 1μM G4 solution, incubate at 37°C for 3h to form a G4 / hemin solution;
[0046] (3) Mix 200 μL ...
Embodiment 2
[0050] Others are with embodiment 1, when carrying out step (4), add H 2 o 2 After the aqueous solution, start the test by adding H 2 o 2 The ultraviolet absorption diagram of the sample test system at different times after the aqueous solution, the test time is cut off at 150min; the results are as follows image 3 shown. It can be seen from the figure that adding H 2 o 2 After 50 minutes of aqueous solution, the basic reaction is completed, and the UV absorbance value at this time reaches the maximum, which also proves the success of the covalent cross-linking of the short peptide and the successful preparation of a non-viral vector.
Embodiment 3H2
[0051] Example 3H 2 o 2 The concentration of aqueous solution and optimization of incubation conditions
[0052] Others are the same as in Example 1, when performing step (4), add 10 μL of 1 mM H 2 o 2 Aqueous solution, test once every 5 minutes, the whole experiment 60 minutes, detect the corresponding fluorescence intensity, such as Figure 4 As shown in a), the result shows that the 50min basic reaction is completed;
[0053] H in Example 1 2 o 2 The concentration of the aqueous solution was replaced by 50μМ, 100μМ, 200μМ, 400μМ, 800μМ, 1mM, 2mM, 5mM, and after incubation at 37°C for 40min, the fluorescence intensity corresponding to different concentrations was detected at the excitation wavelength of 315nm, as shown in Figure 4 As shown in b), the result shows that H 2 o 2 The optimal concentration of the aqueous solution is 1 mM.
PUM
Property | Measurement | Unit |
---|---|---|
Size | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com