Neophocaena asiaeorientalis asiaeorientalis detection kit based on environmental DNA and application of Neophocaena asiaeorientalis asiaeorientalis detection kit
A detection kit and the technology of the kit are applied in the directions of recombinant DNA technology, DNA/RNA fragment, determination/inspection of microorganisms, etc., which can solve the problems such as the inability to detect the existence of the Yangtze finless porpoise and the poor DNA amplification ability of the finless porpoise, etc. High success rate, reduced false positive interference, short time-consuming effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] In this embodiment, the sensitivity of the primers of the present invention is detected, and the specific operations are as follows:
[0050] The finless porpoise tissue DNA was taken as a positive standard, and the primers AAGCTGGAATTCTTTTATAAACTACTC and AACTATCTGTATGATTTCATTATGGG were used for 3 repeated PCR amplifications. The sequence length was 947bp. At the same time, environmental samples were used as a negative control and DEPC water was used as a blank control. The PCR products were detected by gel electrophoresis. The criterion for judging the success rate is that a single bright band should appear in the 2.0% agarose gel electrophoresis test, and the quantitative concentration of the PCR product should not be lower than 5 ng / μL with qubit after purification by magnetic beads. Mix 3 tubes of PCR products, use 1.2×XP beads to purify, prepare 2.0% agarose gel, add 4 μl of PCR products, add 2 μl of 6×Loading buffer and mix well, electrophoresis detection needs to ...
Embodiment 2
[0060] This embodiment provides a detection kit for Yangtze finless porpoise.
[0061] A Yangtze finless porpoise detection kit, comprising primer sets, probes, nucleic acid detection test strips, recombinase, polymerase, ddH 2 O, PCR buffer solution and nucleic acid extraction kit, said nucleic acid extraction kit includes a sterile syringe, a syringe filter with an integrated 0.45 micron pore size filter, lysate, neutralization tube, washing tube, elution tube, Magnetic beads, magnetic rods.
[0062] Wherein, the upstream primer sequence of the primer set is: TGTCCACTAGCCCTTCATAACCATTATATCCT (5'-3'), the downstream primer sequence of the primer set is: GCTGATTAGTCATTAGTCCATCGAGATGTCTT (5'-3'), and the 5' end of the downstream primer is labeled with Biotin;
[0063] The sequence of the probe is: CCATTAGATCACGAGCTTAATCACCATGCCGCGTGAAACCAGCAAC (5'-3'), the 5' end is marked with FAM; the probe is marked with a dSpacer at a position 30 bases away from the 5' end; the 3' end of t...
Embodiment 3
[0066] In this embodiment, the concentration of DNA extracted by the nucleic acid extraction kit of the present invention is detected. The specific method is:
[0067] The nucleic acid extraction kit of this embodiment includes: a sterile syringe, a syringe filter integrated with a filter with a pore size of 0.45 μm, a lysate, a neutralization tube, a washing tube, an elution tube, magnetic beads, and a magnetic bar.
[0068] Sample source: 12 samples were collected repeatedly at the third Yangtze River Bridge for testing.
[0069] Nucleic acid extraction:
[0070] (1) Use a sterile syringe to draw 500-800ml of water samples, connect the syringe to the syringe filter, push the syringe to let all the water samples pass through the syringe filter, and remove the sterile syringe;
[0071] (2) Add 1 mL of lysate to the syringe filter, shake the syringe filter for 2 minutes, suck out the liquid in the syringe filter, add it to a 1.5 mL centrifuge tube filled with neutralizing sol...
PUM
| Property | Measurement | Unit |
|---|---|---|
| absorbance | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


