Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Neophocaena asiaeorientalis asiaeorientalis detection kit based on environmental DNA and application of Neophocaena asiaeorientalis asiaeorientalis detection kit

A detection kit and the technology of the kit are applied in the directions of recombinant DNA technology, DNA/RNA fragment, determination/inspection of microorganisms, etc., which can solve the problems such as the inability to detect the existence of the Yangtze finless porpoise and the poor DNA amplification ability of the finless porpoise, etc. High success rate, reduced false positive interference, short time-consuming effect

Pending Publication Date: 2021-07-23
NANJING UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The present invention mainly aims at problems such as the poor ability of traditional primers to amplify the finless porpoise DNA in environmental samples, and the fact that fluorescence quantitative PCR amplification relies on expensive equipment, which makes it impossible to detect the existence of the Yangtze finless porpoise on site. A pair of isothermal amplification primers is designed based on the Yangtze finless porpoise DNA. and probes, and developed a Yangtze finless porpoise detection kit based on environmental DNA, which can enrich DNA in water on site, rapidly and efficiently amplify the Yangtze finless porpoise gene at room temperature, and can quickly detect the amplification products, so as to realize the detection of Rapid Detection of the Existence of the Yangtze Finless Porpoise

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Neophocaena asiaeorientalis asiaeorientalis detection kit based on environmental DNA and application of Neophocaena asiaeorientalis asiaeorientalis detection kit
  • Neophocaena asiaeorientalis asiaeorientalis detection kit based on environmental DNA and application of Neophocaena asiaeorientalis asiaeorientalis detection kit
  • Neophocaena asiaeorientalis asiaeorientalis detection kit based on environmental DNA and application of Neophocaena asiaeorientalis asiaeorientalis detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] In this embodiment, the sensitivity of the primers of the present invention is detected, and the specific operations are as follows:

[0050] The finless porpoise tissue DNA was taken as a positive standard, and the primers AAGCTGGAATTCTTTTATAAACTACTC and AACTATCTGTATGATTTCATTATGGG were used for 3 repeated PCR amplifications. The sequence length was 947bp. At the same time, environmental samples were used as a negative control and DEPC water was used as a blank control. The PCR products were detected by gel electrophoresis. The criterion for judging the success rate is that a single bright band should appear in the 2.0% agarose gel electrophoresis test, and the quantitative concentration of the PCR product should not be lower than 5 ng / μL with qubit after purification by magnetic beads. Mix 3 tubes of PCR products, use 1.2×XP beads to purify, prepare 2.0% agarose gel, add 4 μl of PCR products, add 2 μl of 6×Loading buffer and mix well, electrophoresis detection needs to ...

Embodiment 2

[0060] This embodiment provides a detection kit for Yangtze finless porpoise.

[0061] A Yangtze finless porpoise detection kit, comprising primer sets, probes, nucleic acid detection test strips, recombinase, polymerase, ddH 2 O, PCR buffer solution and nucleic acid extraction kit, said nucleic acid extraction kit includes a sterile syringe, a syringe filter with an integrated 0.45 micron pore size filter, lysate, neutralization tube, washing tube, elution tube, Magnetic beads, magnetic rods.

[0062] Wherein, the upstream primer sequence of the primer set is: TGTCCACTAGCCCTTCATAACCATTATATCCT (5'-3'), the downstream primer sequence of the primer set is: GCTGATTAGTCATTAGTCCATCGAGATGTCTT (5'-3'), and the 5' end of the downstream primer is labeled with Biotin;

[0063] The sequence of the probe is: CCATTAGATCACGAGCTTAATCACCATGCCGCGTGAAACCAGCAAC (5'-3'), the 5' end is marked with FAM; the probe is marked with a dSpacer at a position 30 bases away from the 5' end; the 3' end of t...

Embodiment 3

[0066] In this embodiment, the concentration of DNA extracted by the nucleic acid extraction kit of the present invention is detected. The specific method is:

[0067] The nucleic acid extraction kit of this embodiment includes: a sterile syringe, a syringe filter integrated with a filter with a pore size of 0.45 μm, a lysate, a neutralization tube, a washing tube, an elution tube, magnetic beads, and a magnetic bar.

[0068] Sample source: 12 samples were collected repeatedly at the third Yangtze River Bridge for testing.

[0069] Nucleic acid extraction:

[0070] (1) Use a sterile syringe to draw 500-800ml of water samples, connect the syringe to the syringe filter, push the syringe to let all the water samples pass through the syringe filter, and remove the sterile syringe;

[0071] (2) Add 1 mL of lysate to the syringe filter, shake the syringe filter for 2 minutes, suck out the liquid in the syringe filter, add it to a 1.5 mL centrifuge tube filled with neutralizing sol...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
absorbanceaaaaaaaaaa
Login to View More

Abstract

The invention discloses a rapid detection method for a fresh water rare mammal, namely, a neophocaena asiaeorientalis asiaeorientalis, in a fresh water environment, and belongs to the technical field of biology. According to the invention, a pair of isothermal amplification primers and probes are designed on the basis of the whole mitochondrial group of the Neophocaena asiaeorientalis asiaeorientalis in China, the primers have the characteristics of good specificity and high stability, the success rate in isothermal PCR amplification is high, the DNA of the Yangtze River finless guinea can be well subjected to PCR amplification, and the primers and probes can be widely applied to the research of rapid detection of the DNA of the Neophocaena asiaeorientalis asiaeorientalis, species protection and the like. The invention also provides a kit for rapid detection of the Neophocaena asiaeorientalis asiaeorientalis genes in cooperation with an environmental DNA technology and an isothermal amplification PCR technology, sequencing is not needed, positive or negative results can be obtained through a nucleic acid detection test strip, the cost is low, the operation is simple and convenient, the consumed time is 10-20 minutes, and the Neophocaena asiaeorientalis asiaeorientalis genes in a fresh water environment can be rapidly and accurately detected.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to an environmental DNA-based detection kit for Yangtze finless porpoise and its application. Background technique [0002] The Yangtze finless porpoise (Neophocaenaphocaenoidesasiaeorientalis) is a small toothed whale listed as a national second-class protected animal. It is mainly distributed in the middle and lower reaches of the Yangtze River, Dongting Lake and Poyang Lake and their main tributaries. It is a relatively independent freshwater subspecies. In recent years, due to shipping, over-fishing and illegal fishing, the population of the Yangtze finless porpoise has declined rapidly. It has now been listed as a "critically endangered" (CR) species by the Species Survival Commission of the International Union for Conservation of Nature (IUCN SSC). It is imminent to detect and protect the Yangtze finless porpoise. [0003] Environmental DNA is the DNA fragments release...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12Q1/6844C12N15/11
CPCC12Q1/6888C12Q1/6844C12Q2531/119C12Q2521/507C12Q2537/1376C12Q2565/625
Inventor 杨江华张效伟
Owner NANJING UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com