Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of tRF expression primer in detection tissue in preparation of laryngeal cancer auxiliary diagnosis kit

A technology for auxiliary diagnosis and kits, which is applied in the fields of biochemical equipment and methods, and the determination/examination of microorganisms.

Active Publication Date: 2021-09-28
NINGBO MEDICAL CENT LIHUILI HOSPITACL
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, early diagnosis and early treatment are the most effective ways to reduce the mortality rate of laryngeal cancer and improve the survival rate and quality of life of patients. Laryngeal cancer has an insidious onset and lacks early specific symptoms, and most patients are often in the middle and late stages when they seek medical attention [MengY, Bian L, Zhang M, Bo F, Lu X, Li D. Liquid biopsy and their application progressin head and neck cancer: Focus on biomarkers CTCs, cfDNA, ctDNA and EVs[J]. Biomark Med.2020, 14, 1393-1404.], unlike liver cancer and prostate cancer, laryngeal cancer still lacks specific markers such as alpha-fetoprotein and prostate-specific antigen. The current gold standard for laryngeal cancer diagnosis is tissue biopsy under laryngoscope, but there are disadvantages such as large trauma, difficulty in obtaining materials, lag and some patients are not suitable, and it is impossible to achieve extensive and efficient diagnosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of tRF expression primer in detection tissue in preparation of laryngeal cancer auxiliary diagnosis kit
  • Application of tRF expression primer in detection tissue in preparation of laryngeal cancer auxiliary diagnosis kit
  • Application of tRF expression primer in detection tissue in preparation of laryngeal cancer auxiliary diagnosis kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] To detect the expression of tRF-33-Q1Q89P9L842205 in laryngeal cancer tissue and normal laryngeal tissue:

[0036] Sequencing detection: The next-generation sequencing method was used to detect the level of tiRNA in laryngeal cancer tissues and normal tissues using tiRNA sequencing reagents from Arraystar in the United States.

[0037] Analysis of the results: the results are as follows figure 1 As shown, by analyzing laryngeal cancer tissues and adjacent tissues to obtain molecular markers expressing significantly down-regulated tRNA-derived fragments, tRF-33-Q1Q89P9L842205 was 2.94-fold different between laryngeal cancer tissues and normal tissues, as shown in figure 1 The arrows indicate that tRF-33-Q1Q89P9L842205 may function as a tumor suppressor gene in laryngeal cancer.

Embodiment 2

[0039] Collect normal laryngeal tissue as a normal control group, and perform tiRNA detection according to the following steps, including the following steps:

[0040] Step a. Collect laryngeal cancer tissue samples: Take 10-20 mg of laryngeal cancer tissue and immerse it in a nuclease-free centrifuge tube containing 1-2 mL of RNA preservation solution; if not used immediately, it should be stored in a -80°C ultra-low temperature refrigerator save;

[0041] Step b. Lysate tissue: Take the tissue in step a out of the -80°C refrigerator and thaw it at room temperature. After the RNA preservation solution is dried by filter paper, about 15 mg of tissue is cut from multiple sites and added to 1 mL of Trizol reagent in advance. In a 2mL nuclease-free centrifuge tube, use an electric homogenizer to fully grind the laryngeal cancer tissue into a homogenate, and incubate at 15-30°C for 10 minutes to completely dissociate the nucleic acid-protein complex;

[0042] Step c, chloroform e...

Embodiment 3

[0064] Method for detecting laryngeal cancer using tRF-33-Q1Q89P9L842205 biomarker

[0065] Steps include:

[0066] 1. Collect tissue samples;

[0067] 2. Extraction of RNA from laryngeal cancer tissue (extraction method is the same as in Example 2);

[0068] 3. The specific reverse transcription and fluorescent dye method qRT-PCR detection is performed as in the "specific reverse transcription and fluorescent dye method qRT-PCR detection" in Example 2;

[0069] 4. Using tRF-33-Q1Q89P9L842205 as a biomarker for detection of laryngeal cancer, the expression levels of tRF-33-Q1Q89P9L842205 in cancer tissues and adjacent tissues of 45 patients with laryngeal cancer were analyzed. The ΔCq of tRF-33-Q1Q89P9L842205 in the laryngeal cancer patient group was significantly higher than that in the normal group, P image 3 shown. The cut-off value of tRF-33-Q1Q89P9L842205 as a laryngeal cancer marker is -4.09. When the PCR relative quantitative value ΔCq of the tRF-33-Q1Q89P9L842205 bi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention relates to application of a tRF expression primer in detection tissue in preparation of a laryngeal cancer auxiliary diagnosis kit. The tRF expression primer is characterized in that the nucleotide sequence of tRF-33-Q1Q89P9L842205 is shown as SEQ ID NO: 1, and the specific expression of the tRF-33-Q1Q89P9L842205 in the tissues of laryngeal cancer patients is reduced: the primer is F1: 5'ATAAGCGCCGCTGGTGTAGTG3'; and R1: 5'TATGGTTGTTGACGACTGGTTGAC3'. Compared with the prior art, the tRF expression primer has the advantage that specific expression down-regulated tRF-33-Q1Q89P9L842205 in laryngeal cancer tissues can be used as a novel molecular marker for laryngeal cancer diagnosis.

Description

technical field [0001] The invention relates to a method for detecting tRNA-derived fragments in laryngeal cancer tissue, in particular to a method for detecting tiRNA in laryngeal cancer tissue by real-time quantitative reverse transcription-polymerase chain reaction using a fluorescent dye method and its application. Background technique [0002] Laryngeal cancer is one of the common malignant tumors of the head and neck. The patients are mainly males over 40 years old, and there is a trend of younger patients. Although CO 2 New technologies such as laser microscopy, robotics, and combined radiotherapy and chemotherapy have been applied to the treatment of laryngeal cancer, but the mortality rate has not been significantly reduced. The main reason is that most of these techniques can only benefit patients with early-stage laryngeal cancer, while patients with middle-advanced laryngeal cancer still need total or hemilaryngectomy, which is often accompanied by problems such...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886C12Q1/6851C12Q1/6806
CPCC12Q1/6886C12Q1/6851C12Q1/6806C12Q2600/158C12Q2600/178C12Q2600/166C12Q2521/107C12Q2531/113C12Q2545/113C12Q2563/107
Inventor 邓红霞周重昌沈志森叶栋刘开泰顾姗姗
Owner NINGBO MEDICAL CENT LIHUILI HOSPITACL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com