47 results about "Larynx carcinoma" patented technology

The present invention relates to the use of a compound of formula 3 or a salt thereof for preparing a medicament or a phototherapeutic agent for the treatment of the following diseases, including: acne; AIDS; viral hepatitis; diabetic retinopathy; atypical pneumonia virus infection; coronary Arterial stenosis; carotid artery stenosis; intermittent claudication; Asian (chicken) avian influenza virus infection; cervical dysplasia or various cancers including: blood cancer, cervical cancer, nasopharyngeal cancer, tracheal cancer, laryngeal cancer, bronchial cancer , bronchiolar cancer, bladder cancer, esophagus cancer, stomach cancer, rectal cancer, colon cancer, prostate cancer, hollow organ cancer, bile duct cancer, urinary duct cancer, kidney cancer, uterine cancer, vaginal cancer and other gynecological adnexal cancers. The present invention also relates to methods of treating the above diseases. The present invention further relates to the use of a compound of formula 3 or a salt thereof for the preparation of a photodiagnostic agent for the detection of the above-mentioned diseases and diseases including: atherosclerosis, multiple sclerosis, diabetes, arthritis, rheumatism Arthritis, fungal infection, viral infection, chlamydia infection, bacterial infection, or parasitic infection, HIV infection, hepatitis, herpes simplex, shingles, psoriasis, cardiovascular disease and skin disease. The present invention also relates to methods of detecting the above diseases using photodiagnostic agents. The present invention further relates to a method of cryogenically sterilizing a surgical device or other device, comprising the steps of: providing a compound of formula 3 or a salt thereof on the device; subjecting the device to radiation treatment or sonication. The present invention further relates to a compound of formula 3 or a salt thereof linked or attached to a magnetic element. This compound acts as an MRI enhancer. The present invention also relates to the use of such MRI enhancers for performing MRI scans.

The invention relates to an application of recombinant ganoderma lucidum immunomodulatory protein rLZ-8 in treating lung cancer, laryngocarcinoma and brain glioma. According to the invention, the in-vivo anti-tumor effect of the rLZ-8 is researched by respectively building a lung cancer mice model by virtue of a caudal vein injection method and building a laryngocarcinoma and brain glioma nude mice animal model by virtue of a subcutaneous transplantation tumor method; a treatment result indicates that the rLZ-8 achieves an obvious anti-tumor effect on the lung cancer, the laryngocarcinoma and the brain glioma.

The invention relates to a mussel adhesive protein (MAP) and an application thereof in inhibiting catarrh, and specifically, to applications of a MAP or a product thereof in oral mucositis, rhinitis, otitis media, pharyngitis, laryngitis, bronchitis, esophagitis, gastritis, enteritis, cervicitis, endomyometritis, inflammation resulting from inhalation injury, and oral cavity cancer, nasopharyngeal cancer, carcinoma of middle ear, conjunctival cancer, laryngeal cancer, lung cancer, esophageal cancer, stomach cancer, bowel cancer, cervical cancer, endometrial cancer, and other cancers resulting from the inflammation. The MAP can inhibit symptoms such as flush, fever, swell, and pain owing to catarrh, facilitating healing, relieving itch and pain, and having broad applications in the fields of medicines, cosmetics, medical products, disinfection products, healthcare products, foods, and household goods.

The invention provides a traditional Chinese medicine preparation and for main treatment of esophagus cancer and a preparation method thereof, and the traditional Chinese medicine preparation is prepared by selection of pearl, ginseng, calculus bovis, bear gall, borneol, stiff silkworm, house lizard, centipede, pseudo-ginseng, menthol, cinnabar, borax, smoked plum, propolis, tendril-leaved fritillary bulb, ephedra, pinellia tuber, scutellaria barbata and other medicinal materials. The traditional Chinese medicine preparation has the main effects of downbearing counterflow and checking vomiting, eliminating phlegm and detoxifying, softening hardness and dissipating stasis, transforming putridity and promoting tissue regeneration, dredging esophagus, relieving pain, and suppressing and resisting cancer. The traditional Chinese medicine preparation has good effects on esophageal discomfort, dysphagia, esophageal stenosis and obstruction caused by early and middle-late esophageal cancer, can kill cancer cells and inhibit the growth of the cancer cells, prevents the spread of the cancer cells, improves microcirculation, can be used for spasmolysis of smooth muscle so as to inhibit cancer cell growth and metastasis, is mainly used for esophageal cancer, also has certain curative effect on cardiac cancer, gastric cancer, ingluveosis phrenospasm, laryngeal cancer, lung cancer, liver cancer, breast cancer, pancreatic cancer, cervical cancer, intestinal cancer, esophagitis, various kinds of pharyngolaryngitis and the like.

The invention provides a total-nutrient formula food for laryngocarcinoma patients, a specific total-nutrient formula food or a non-total-nutrient formula food. The formula food is prepared by crushing and mixing a plurality of types of medicinal and edible Chinese medicine extract essences, a plurality of types of micro-encapsulated probiotic bacteria, short peptide, prebiotics, amino acid, carbohydrate, a plurality of types of vitamins and minerals together by combining physical characteristics of laryngocarcinoma patients according to requirements of 'General Principles for Special Medical Formula Foods', wherein the plurality of types of the medicinal and edible Chinese medicine extract essences are extracted by virtue of a prehydrolysis SBE (Starch Branching Enzyme) technology, and the short peptide, prebiotics, amino acid, carbohydrate and vitamins are extracted by virtue of biological enzymolysis. The food not only can be used as a single nutrient source to meet nutritional requirements of the laryngocarcinoma patients, but also can achieve effects of clearing heat and eliminating phlegm, dispelling wind and relieving sore-throat, eliminating mass and relieving swelling, promoting blood circulation to dispel blood stasis, supplementing qi and nourishing yin, dissipating and discharging stagnated fire and strengthening immunity.

The present invention belongs to the technical field of medicinal and edible food formulas and new resource foods and specifically provides non-whole nutrient formula food, special whole nutrient formula food or whole nutrient formula food for patients with laryngocarcinoma to eat. According to the requirements of General Principles of Special Medical Use Formula Foods, in combination with the constitutive characters of the patients with laryngocarcinoma, and based on the essence of traditional Chinese medicine theory, a variety of medicinal and edible traditional Chinese medicines are reasonably combined; a plurality of types of traditional Chinese medicine extract essences which are extracted by a prehydrolysis SBE technology, oligopeptides extracted by biological enzymolysis, prebiotics, amino acids, carbohydrates, fats with healthcare functions, a plurality of types of vitamins and mineral substances are mixed and then treated by other processes, thereby obtaining the formula food. The formula food can be used as a single nutrient source to meet the nutritional requirements of the patients with laryngocarcinoma, and also has effects of clearing heat and eliminating phlegm, dispelling wind and relieving sore-throat, eliminating mass and relieving swelling, treating cough and asthma, removing phlegm and improving immunity.

The invention relates to application of a tRF expression primer in detection tissue in preparation of a laryngeal cancer auxiliary diagnosis kit. The tRF expression primer is characterized in that the nucleotide sequence of tRF-33-Q1Q89P9L842205 is shown as SEQ ID NO: 1, and the specific expression of the tRF-33-Q1Q89P9L842205 in the tissues of laryngeal cancer patients is reduced: the primer is F1: 5'ATAAGCGCCGCTGGTGTAGTG3'; and R1: 5'TATGGTTGTTGACGACTGGTTGAC3'. Compared with the prior art, the tRF expression primer has the advantage that specific expression down-regulated tRF-33-Q1Q89P9L842205 in laryngeal cancer tissues can be used as a novel molecular marker for laryngeal cancer diagnosis.

The invention discloses a pharmaceutical composition for treating tongue cancer and laryngocarcinoma. The pharmaceutical composition is prepared from the following raw materials in parts by weight: 12-24 parts of cynanchum paniculatum, 12-24 parts of solanum lyratum, 12-24 parts of mock-strawberry, 12-24 parts of sapindus mukorossi gaertn root, 12-24 parts of Chinese actinidia root, 12-24 parts of pseudo-ginseng, 12-24 parts of ginseng, 12-24 parts of astragalus membranaceus, 12-24 parts of desert cistanche, 12-24 parts of nightshade, 12-24 parts of spina gleditsiae, 12-24 parts of indigo naturalis, 12-24 parts of air potato, 9-21parts of calculus bovis factitious, 9-21parts of subprostrate sophora, 9-21parts of calomel, 9-21parts of musk, 9-21parts of borneol, 9-21parts of salviae miltiorrhizae and 9-21parts of talcum powder, the raw materials are combined to active components, the pharmaceutical composition has a good curative effect on tongue cancer and laryngocarcinoma. The invention further discloses use of the pharmaceutical composition.

The present invention relates to high-throughput methods comprising direct infusion electrospray ionization mass spectrometry (ESI-MS), multistep tandem mass spectrometry (MSn), consecutive reaction monitoring (CRM), ion mobility spectrometry mass spectrometry (IMS-MS), high-resolution MS, and IMS-MS, for genome-wide (whole cell or tissue) profiling of DNA and RNA nucleotides / nucleosides having a wide variety of variant structural modifications. In particular, these methods are contemplated for providing a specific profile of variant DNA and / or RNA chemically modified nucleic acids (i.e. structures) associated with specific medical conditions. Medical conditions may include, but are not limited to: cancer; including prostate, lung, uterus, larynx, ovary, breast, kidney, and many other types of cancers; specific stages of cancer; bacterial infections; viral infections; genetic and metabolic disorders; and any condition involving changes in DNA and / or RNA structural modifications.

The invention relates to quercetin which has multiple aspects of biological activities, and has effects of phlegm elimination, asthma relief and antiatheroscloresis, etc., and has activities of fighting against the hyperplasia of various tumor cells; platinum complexes have obvious anticancer effect and the combination use of the quercetin and the cisplatin results in synergistic effects. In the invention, the quercetin reacts with a platinum compound under a certain condition for obtaining a quercetin platinum complex by being subjected to reversion, distill, chromatography and separation. The results from the MIT method experiment show that the quercetin platinum significantly inhibits the cell proliferation of tumors such as hepatoma HepG2, cervical carcinoma Hela and laryngocarcinoma Hep2, etc.

The invention discloses a pharmaceutical composition for treating and preventing respiratory tract pathogen infection and application, and relates to the technical field of respiratory tract diseases. The inventor finds new application of rotenone. In-vitro and in-vivo experiments prove that the rotenone can reduce the virus titer of human laryngocarcinoma epithelial cells infected by human respiratory syncytial virus (HRSV), improve the survival rate of animals and promote the weight of the infected animals to be gradually increased from low level. Tests prove that the rotenone has a good effect of resisting respiratory pathogens (especially respiratory infection viruses), has a good application prospect when being used for treating and / or preventing respiratory pathogen infection, and can be developed into corresponding drugs for treating or preventing respiratory pathogen infection. And good news is brought to pneumonia patients such as viral pneumonia.

The invention discloses a molecular marker related to incidence and development of laryngeal carcinoma. The molecular marker is LOC100507437. According to the molecular marker related to incidence anddevelopment of laryngeal carcinoma, QPCR research proves that expression of LOC100507437 in laryngeal squamous cell carcinoma tissue is significantly up-regulated compared with those of control groups, and according to the differential expression characteristic of LOC100507437, LOC100507437 can be used as the molecular marker for diagnosing laryngeal squamous cell carcinoma. Moreover, an in-vitroexperiment proves that expression of LOC100507437 is related to proliferation and migration of laryngeal squamous cell carcinoma so that LOC100507437 can be used as a molecular target for treating laryngeal squamous cell carcinoma.

Provided herein are methods for detecting a head and neck cancer of the oral cavity or throat, optionally oral squamous cell carcinoma, comprising executing the step of determining the expression of two or more miRNA in a biological sample obtained from a subject, wherein the two or more miRNA are selected from the group consisting of hsa-let-7a, hsa-miR-16, hsa-miR-21, hsa-miR-451, hsa-miR-486-5pand hsa-miR-92a- 3p, and wherein the level of expression of said two or more niiRNAs in the biological sample relative to the level of expression of said two or more miRNAs in one or more cancer-freereference samples is indicative of the presence of a head and neck cancer of the oral cavity or throat of the subject.

The invention relates to the technical field of anticancer drugs, in particular to a pharmaceutical composition for treating laryngeal cancer, a preparation method and application thereof. The active ingredients of the pharmaceutical composition include biflavones of spicantia chinensis, biflavones of ginkgo biloba, biflavones of cypresses, biflavones of bamboo and cypresses, 7‑desmethyl biflavones of ginkgo biloba and 7,4',7", 4"'‑tetramethoxy Biflavonoids of Suicha fir. The pharmaceutical composition has good effect on treating laryngeal cancer.

The application relates to application of interferon alpha-1a in preparing drugs for treating cancer, specifically to the application of the interferon alpha-1a in preparing drugs for treating cervical cancer, laryngeal carcinoma and pancreatic cancer. The interferon alpha-1a can obviously inhibit the proliferation of HeLa, HeG2, SW1990 and MIA-PaCa-2 cells and promote apoptosis of the cells. Theresult suggests that the interferon alpha-1a possibly has the characteristics and potential of resisting the cervical cancer, the laryngeal carcinoma and the pancreatic cancer and provides a new clueand theoretical basis for clinical treatment of cancer.

The invention relates to an application of recombinant ganoderma lucidum immunomodulatory protein rLZ-8 in treating lung cancer, laryngocarcinoma and brain glioma. According to the invention, the in-vivo anti-tumor effect of the rLZ-8 is researched by respectively building a lung cancer mice model by virtue of a caudal vein injection method and building a laryngocarcinoma and brain glioma nude mice animal model by virtue of a subcutaneous transplantation tumor method; a treatment result indicates that the rLZ-8 achieves an obvious anti-tumor effect on the lung cancer, the laryngocarcinoma and the brain glioma.