gRNAs, kits and vector systems for detection of pine xylophilus
The technology of a pine wood nematode and a kit is applied in the field of biological detection to achieve the effects of good detection specificity, good sensitivity and convenient operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0108] Example 1 Design and screening of CRISPR / Cas12a detection primer gRNA for pine xylophilus
[0109] 1. Selection of target sequence
[0110] On the basis of previous research, after multiple screening and comparison, a sequence with a difference of about 20 bases in the 5S rDNA region of B. xylophilus and its close relative B. xylophilus, such as SEQ ID NO: 4, was selected is a target sequence, which is a specific conserved sequence of pine xylophilus, and can specifically detect pine xylophilus.
[0111] 2. Design of gRNA specifically targeting the 5S rDNA gene of B. xylophilus
[0112] The design of LbCas12agRNA follows the following four principles:
[0113] (1) The gRNA sequence format is: 5'-framework nucleic acid fragment interacting with LbCas12a nuclease-guide sequence-3'. The framework nucleic acid fragment corresponding to LbCas12a is AAUUUUCUACUGUUGUAGAU (SEQ ID NO:2);
[0114] (2) Linking the framework nucleic acid fragment interacting with LbCas12a nucle...
Embodiment 2
[0126] Embodiment 2, establishment of the method for detecting pine xylophilus
[0127] 1. Synthesize oligo DNA and transcribe it into gRNA
[0128] Use rTaq 10X PCR buffer (TaKaRa) to anneal the oligo DNA template of gRNA into double-stranded DNA. The annealing system is shown in Table 3 below.
[0129] table 3
[0130]
[0131] In the above reaction system, the concentration of oligo DNA and T7 promoter is 100µM, and the concentration of Standard Taqbuffer is 10×.
[0132] The annealing procedure is as follows:
[0133] 95°C 5min; 94°C to 25°C (0.1°C / s); 25°C ∞.
[0134] According to the instruction of HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs), T7 RNA polymerase was used to transcribe the annealed product dsDNA (gRNA) obtained in the previous step to obtain gRNA.
[0135] The above transcription system is shown in Table 4 below.
[0136] Table 4
[0137]
[0138] In the above reaction system, the final concentration of NTP buffer is 6....
Embodiment 3
[0169] Embodiment 3, specificity and sensitivity test
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap