Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

gRNAs, kits and vector systems for detection of pine xylophilus

The technology of a pine wood nematode and a kit is applied in the field of biological detection to achieve the effects of good detection specificity, good sensitivity and convenient operation

Active Publication Date: 2021-12-24
BEIJING FORESTRY UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Based on this, it is necessary to provide a crRNA, kit and vector system for detecting pine xylophilus for the detection of pine wood nematode.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • gRNAs, kits and vector systems for detection of pine xylophilus
  • gRNAs, kits and vector systems for detection of pine xylophilus
  • gRNAs, kits and vector systems for detection of pine xylophilus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0108] Example 1 Design and screening of CRISPR / Cas12a detection primer gRNA for pine xylophilus

[0109] 1. Selection of target sequence

[0110] On the basis of previous research, after multiple screening and comparison, a sequence with a difference of about 20 bases in the 5S rDNA region of B. xylophilus and its close relative B. xylophilus, such as SEQ ID NO: 4, was selected is a target sequence, which is a specific conserved sequence of pine xylophilus, and can specifically detect pine xylophilus.

[0111] 2. Design of gRNA specifically targeting the 5S rDNA gene of B. xylophilus

[0112] The design of LbCas12agRNA follows the following four principles:

[0113] (1) The gRNA sequence format is: 5'-framework nucleic acid fragment interacting with LbCas12a nuclease-guide sequence-3'. The framework nucleic acid fragment corresponding to LbCas12a is AAUUUUCUACUGUUGUAGAU (SEQ ID NO:2);

[0114] (2) Linking the framework nucleic acid fragment interacting with LbCas12a nucle...

Embodiment 2

[0126] Embodiment 2, establishment of the method for detecting pine xylophilus

[0127] 1. Synthesize oligo DNA and transcribe it into gRNA

[0128] Use rTaq 10X PCR buffer (TaKaRa) to anneal the oligo DNA template of gRNA into double-stranded DNA. The annealing system is shown in Table 3 below.

[0129] table 3

[0130]

[0131] In the above reaction system, the concentration of oligo DNA and T7 promoter is 100µM, and the concentration of Standard Taqbuffer is 10×.

[0132] The annealing procedure is as follows:

[0133] 95°C 5min; 94°C to 25°C (0.1°C / s); 25°C ∞.

[0134] According to the instruction of HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs), T7 RNA polymerase was used to transcribe the annealed product dsDNA (gRNA) obtained in the previous step to obtain gRNA.

[0135] The above transcription system is shown in Table 4 below.

[0136] Table 4

[0137]

[0138] In the above reaction system, the final concentration of NTP buffer is 6....

Embodiment 3

[0169] Embodiment 3, specificity and sensitivity test

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gRNA for detecting pine xylophilus, comprising a) a guide sequence such as SEQ ID NO: 1, which can hybridize to a target nucleotide sequence, and b) a framework nucleic acid fragment interacting with Cas nuclease . The invention also discloses a kit for detecting pine xylophilus, which comprises the gRNA or the DNA that can be transcribed into the gRNA. The present invention also discloses a vector system, which comprises one or more vectors, the vector comprising: a first regulatory element and a second regulatory element, the first regulatory element is operably linked to a nucleoside encoding Cas nuclease An acid fragment, the second regulatory element is operably linked to the nucleotide fragment encoding the gRNA.

Description

technical field [0001] The invention relates to the technical field of biological detection, in particular to a gRNA, a kit and a carrier system for detecting pine xylophilus. Background technique [0002] Pine wilt disease, namely pine wilt disease, is one of the four major forest diseases in the world today, known as the "cancer" of pine trees, and the pathogen that causes the disease is pine wood nematode, which belongs to the second-level quarantine object in my country. Since pine wood nematodes cannot be directly observed with the naked eye, professional equipment and personnel are needed. Distinguishing and identifying pine wood nematodes is not only a heavy task for quarantine personnel, but also a great challenge. Effective identification of pine wood nematode plays a vital role in controlling its harm and timely blocking its transmission and spread. At present, the main methods for identification of pine wood nematode species at entry and exit ports are morphologi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6888C12Q1/6844C12N15/113
CPCC12Q1/6888C12Q1/6844C12Q2600/178C12Q2521/507C12Q2522/101C12Q2521/327
Inventor 王永林武瑾唐晨尹康权李学武
Owner BEIJING FORESTRY UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com