Wheat single plant spike number and heat resistance character related SNP locus and application thereof
A locus, wheat technology, applied in the field of molecular biology, can solve the problems of being easily affected by the environment, difficult to improve genetic breeding of wheat, and complex regulation mechanism of wheat panicle number per plant.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1 SNPs and PCR-Enzyme Cutting Polymorphism Detection Related to the Number of Spikes Per Plant of Wheat
[0031] 1. Specific primers and sequence analysis for amplifying the genomic fragment containing the SNP in wheat
[0032] A SNP was found in the gene HSF coding region on the wheat genome, corresponding to the 1875th position from the 5' end of SEQ ID NO: 1 in the sequence table; there are two genotypes at this site in the wheat natural variation population:
[0033] Genotype A: G
[0034] Genotype B: C
[0035] According to the sequence differences of different genomes of wheat, specific primers were designed to PCR amplify the DNA fragments respectively including the SNP site:
[0036] F1: CCAGACAGATGGGAGTTCG (SEQ ID NO: 2);
[0037] R1: GGTTCTGTATTGCTCTTGCCAGG (SEQ ID NO: 3);
[0038] F2: ATCACAGCAGCAGGCTCTTGG (SEQ ID NO: 4);
[0039] R2: GCTGCTCCTGCCTCAGTTTCACGA (SEQ ID NO: 5).
[0040] Use F1 and R1 as the target sequence of primer pair PCR amplif...
Embodiment 2
[0062] In 2015, the above-mentioned natural group wheat was planted in the dry land of the Experimental Farm of the Institute of Crop Science of the Chinese Academy of Agricultural Sciences (Shunyi, Beijing), and in 2016 in the dry and wet land of the Experimental Farm of the Institute of Crop Science of the Chinese Academy of Agricultural Sciences (Shunyi and Changping, Beijing). The number of spikes per plant of each wheat variety is associated with the situation of the number of spikes per plant and the polymorphic site with Tassel2.1 software, and the mixed linear model+population structure (MLM+(Q+K)) method is selected to carry out Analysis, with P<0.05 as the significance level, the results are shown in Table 2.
[0063] Table 2 Correlation analysis results between the situation of WFZP-A gene polymorphism site and the number of spikes per plant in natural populations
[0064]
[0065]
[0066] The results of association analysis in Table 2 showed that the differe...
Embodiment 3
[0068] In embodiment 2, the result analysis of association analysis finds that there are 4 thermal environments among the 10 environments investigated, and wherein there are 3 thermal environments where the difference in the number of spikes per plant reaches extremely significant (P<0.05), so it is considered that HSF- The A gene has a high degree of correlation with the environmental factor of heat. Therefore, based on the above correlation analysis results, the four environments were divided into heat and normal, and the number of spikes per plant of the two genotypes was counted. The results are shown in Table 3.
[0069] Table 3 Quantitative difference in panicle number per plant of the two haplotypes of HSF-A gene in the four associated environments
[0070]
[0071] The results in Table 3 show that under normal conditions type I is 19.06% less than type II, and under hot conditions, type I is 10.15% less than type II. In summary, type I is a low number of spikes per p...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More