3-ketoacyl coenzyme A thiolase gene RKACAA1-2 and application thereof
A technology of ketoacyl coenzyme and thiolase, applied in the fields of biology and genetic engineering, can solve the problems of chemically synthesized carotenoids and the safety of chemically synthesized pigments.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] Embodiment 1: from Rhodosporidium yeast ( Rhodosporidium kratochvilovae 3-ketoacyl-CoA thiolase gene isolated from YM25235 RKACAA1 -2 and its overexpression vector pRHRKACAA1-2 construction
[0018] The total RNA of Rhodosporidium YM25235 was extracted using the UNlQ-10 Column Trizol Total RNA Extraction Kit (product number: SK1321) of Sangon Bioengineering (Shanghai) Co., Ltd., and then followed by Vazyme’s kit (product number: R212-02) HiScript II 1st Strand cDNA Synthesis Kit (+gDNA wiper) was used for reverse transcription to synthesize cDNA, and 1 μL was used as a template for polymerase chain reaction. RKACAA1 -2 sequence, design specific primers RKACAA1-2-F and RKACAA1-2-R, use the cDNA template obtained above to carry out PCR amplification on a PCR instrument (Beijing Liuyi Biotechnology Co., Ltd.), the primers and components used in the reaction and amplification conditions are as follows:
[0019] RKACAA1-2-F: 5’- ATCACTCACCATGGCGGATCC TATGGCCAGCCTCATT...
Embodiment 2
[0027] Example 2: Analysis of the relationship between RKACAA1-2 gene and carotenoid synthesis in Rhodosporidium yeast
[0028] 1. Transform Rhodosporidium YM25235
[0029] The single clone of the DH5α strain that was successfully transferred to the correct recombinant vector pRHRKACAA1-2 was picked and inserted into LB liquid medium (containing 100 μg / mL spectinomycin) for overnight culture, and the plasmid was extracted (OMEGA Plasmid Mini Kit I, OMEGA, USA), and Measure the concentration and store it at -20°C for later use; pick a single colony of Rhodosporidium YM25235 and inoculate it in 5 mL of YPD liquid medium, and culture it overnight at 30°C and 200 rpm with shaking; inoculate the overnight cultured bacterial solution with 1% The amount was transferred to 50mL YPD liquid medium at 30°C and 200rpm shaking culture until the bacterial liquid OD 600 Centrifuge the culture at 4°C and 4500 rpm for 5 minutes to collect the cells; wash the cells with the previously prepared...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com