Unlock instant, AI-driven research and patent intelligence for your innovation.

3-ketoacyl coenzyme A thiolase gene RKACAA1-2 and application thereof

A technology of ketoacyl coenzyme and thiolase, applied in the fields of biology and genetic engineering, can solve the problems of chemically synthesized carotenoids and the safety of chemically synthesized pigments.

Active Publication Date: 2021-11-16
KUNMING UNIV OF SCI & TECH
View PDF13 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The safety of chemically synthesized pigments has been questioned, and some chemically synthesized carotenoids (such as astaxanthin) have been found to be harmful and banned from pharmacies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • 3-ketoacyl coenzyme A thiolase gene RKACAA1-2 and application thereof
  • 3-ketoacyl coenzyme A thiolase gene RKACAA1-2 and application thereof
  • 3-ketoacyl coenzyme A thiolase gene RKACAA1-2 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Embodiment 1: from Rhodosporidium yeast ( Rhodosporidium kratochvilovae 3-ketoacyl-CoA thiolase gene isolated from YM25235 RKACAA1 -2 and its overexpression vector pRHRKACAA1-2 construction

[0018] The total RNA of Rhodosporidium YM25235 was extracted using the UNlQ-10 Column Trizol Total RNA Extraction Kit (product number: SK1321) of Sangon Bioengineering (Shanghai) Co., Ltd., and then followed by Vazyme’s kit (product number: R212-02) HiScript II 1st Strand cDNA Synthesis Kit (+gDNA wiper) was used for reverse transcription to synthesize cDNA, and 1 μL was used as a template for polymerase chain reaction. RKACAA1 -2 sequence, design specific primers RKACAA1-2-F and RKACAA1-2-R, use the cDNA template obtained above to carry out PCR amplification on a PCR instrument (Beijing Liuyi Biotechnology Co., Ltd.), the primers and components used in the reaction and amplification conditions are as follows:

[0019] RKACAA1-2-F: 5’- ATCACTCACCATGGCGGATCC TATGGCCAGCCTCATT...

Embodiment 2

[0027] Example 2: Analysis of the relationship between RKACAA1-2 gene and carotenoid synthesis in Rhodosporidium yeast

[0028] 1. Transform Rhodosporidium YM25235

[0029] The single clone of the DH5α strain that was successfully transferred to the correct recombinant vector pRHRKACAA1-2 was picked and inserted into LB liquid medium (containing 100 μg / mL spectinomycin) for overnight culture, and the plasmid was extracted (OMEGA Plasmid Mini Kit I, OMEGA, USA), and Measure the concentration and store it at -20°C for later use; pick a single colony of Rhodosporidium YM25235 and inoculate it in 5 mL of YPD liquid medium, and culture it overnight at 30°C and 200 rpm with shaking; inoculate the overnight cultured bacterial solution with 1% The amount was transferred to 50mL YPD liquid medium at 30°C and 200rpm shaking culture until the bacterial liquid OD 600 Centrifuge the culture at 4°C and 4500 rpm for 5 minutes to collect the cells; wash the cells with the previously prepared...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a 3-ketoacyl coenzyme A thiolase gene RKACAA1-2, the nucleotide sequence of the 3-ketoacyl coenzyme A thiolase gene RKACAA1-2 is shown as SEQ ID NO: 1, and the amino acid sequence coded by the gene is shown as SEQ ID NO: 2; the gene is separated from rhodosporidium kratochvilovae YM25235, the gene is transferred into the rhodosporidium kratochvilovae YM25235 through transformation, and the experimental result shows that the overexpression of the RKACAA1-2 gene can cause the improvement of the carotenoid synthesis level of the YM25235 strain; according to the gene, the microorganisms are modified by means of genetic engineering, so that the yield of carotenoid in the microorganisms is increased, and a foundation is laid for large-scale commercial production of carotenoid.

Description

technical field [0001] The invention belongs to the field of biotechnology and genetic engineering, and relates to a 3-ketoacyl-CoA thiolase gene RKACAA1-2 and its application. Background technique [0002] Carotenoid is a general term for a class of important natural pigments. It belongs to a class of terpenoids and has multiple conjugated double bonds. The color is generally yellow, orange or red. The structure of carotenoids is based on isoprenoids. Most typical carotenoid chemical structures contain 40 carbon atoms and are polymerized by 8 isoprenoids. According to the type of chemical group at the end of the carbon skeleton, carotenoids can be divided into two categories. One type is closed-ring carotenoids with ring structure, such as α-carotene, β-carotene, lutein, anthocyanin, etc. The other type is open-ring carotenoids that do not contain a ring structure, such as phytoene, lycopene, etc. At present, more than 800 natural carotenoids have been found in higher p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/54C12N1/19C12P23/00C12R1/645
CPCC12N9/1029C12P23/00C12Y203/01174
Inventor 张琦杨晓霞陈功水
Owner KUNMING UNIV OF SCI & TECH