Unlock instant, AI-driven research and patent intelligence for your innovation.

Gene expression cassette, lentiviral vector and application of lentiviral vector in treatment of beta thalassemia

A gene expression cassette and lentiviral packaging technology, applied in the field of biomedicine, can solve problems such as damage to HSC function and differentiation, and achieve the effects of enhanced therapeutic effect, huge economic benefits and social benefits

Inactive Publication Date: 2021-11-26
GUANGZHOU BIO GENE TECH CO LTD
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Constitutive expression of β-globin gene and gene BCL11A regulating γ-globin expression in HSC impairs HSC function and differentiation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene expression cassette, lentiviral vector and application of lentiviral vector in treatment of beta thalassemia
  • Gene expression cassette, lentiviral vector and application of lentiviral vector in treatment of beta thalassemia
  • Gene expression cassette, lentiviral vector and application of lentiviral vector in treatment of beta thalassemia

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0087] vector construction

[0088] The HS3-HS2-promoter DNA sequence, miR E5 (E5-shRNAmir) DNA sequence and intron-miR E5 DNA sequence were synthesized by Guangzhou Aiji Biotechnology Co., Ltd. respectively; and ligated into the lentiviral vector. The main sequences involved in the present invention are shown in the following table:

[0089] name length sequence HS3 1202bp SEQ ID NO: 6 HS2 1411bp SEQ ID NO: 7 βglobin promoter 265bp SEQ ID NO: 3 shRNAmir 316bp SEQ ID NO: 8 PolyA 395bp SEQ ID NO: 4 β-globin gene 1052bp SEQ ID NO: 1 Intron-shRNAmir 356bp SEQ ID NO: 2 pCDH-miR E5-HS2-HS3 9597bp SEQ ID NO: 9 pCDH-βglobin-HS2-HS3 10369bp SEQ ID NO: 10 pCDH-inron-miR E5-βglobin-HS2-HS3 10757bp SEQ ID NO: 5 βglobin protein 147aa SEQ ID NO: 11

[0090] The sequence of E5-shRNA is: passenger strand (gcgcgatcgagtgttgaataa), guide strand (ttatcaacactcgatcgcgc).

Embodiment 2

[0092] The four-plasmid system is used for lentiviral packaging, and the specific steps are as follows:

[0093] (1) The four-plasmid system respectively expresses gag / pol, Rev, VSV-G required for lentiviral vector packaging and the E5-shRNAmir expression vector constructed by the present invention: the four plasmids are transiently transfected into 293T cells, and the DNA content is 2 μg / mL;

[0094] (2) Mix the above plasmid with PEI transfection reagent, add it to a certain volume of serum-free DMEM, mix it and let it stand for 15 minutes, then add the above mixture into the T75 culture flask covered with 293T cells, lightly Mix gently, at 37°C, 5% CO 2 Cultivate in a cell incubator for 6 hours;

[0095] (3) Replace the fresh medium after 6 hours, continue the culture, and add 10 mM sodium butyrate solution, and collect the culture supernatant of the lentivirus after 72 hours for purification and detection.

[0096] (4) Use the lentivirus titer (HIV P24) ELISA detection...

Embodiment 3

[0098] E5-shRNAmir lentivirus infection of MEL cells

[0099] 1. Mouse murine erythroleukemia (MEL cells), cultured in complete medium (1640+10% FBS+1% P / S), subcultured every 2-3 days at a ratio of 1:5 to 1:10.

[0100] 2. Collect the cells by centrifugation at 200g for 5-10min, resuspend the cells in complete medium containing 200nM infection enhancer B, and incubate in the incubator for 2h.

[0101] After 3.2 hours, collect the cells by centrifugation at 200g for 5-10 minutes, resuspend the cells with complete medium, and adjust the density to 5×10 6 individual / mL, inoculate 100uL (5×10 5 per well) into a 48-well plate.

[0102] 4. Add an appropriate amount of lentivirus to make the MOI 15, then add infection enhancer A to make the final concentration of infection enhancer A 10uM, and then gently mix the cells.

[0103] 5. Place the cells in an incubator overnight.

[0104] 6. Wash the overnight cultured cells twice with PBS.

[0105] 7. Then resuspend the cells with c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of biomedical treatment, in particular to a gene expression cassette, a lentiviral vector and application of the lentiviral vector in treatment of beta thalassemia. The gene expression cassette comprises a promoter, a beta globin gene, an intron-BCL11A-shRNAmir and a polyadenylation signal which are sequentially connected; and the promoter is a type II promoter with erythroid cell specificity. The gene expression cassette can specifically up-regulate expression of beta globin and gamma globin in erythroid cells, and the two mechanisms have a synergistic effect, so that the treatment effect is remarkably enhanced.

Description

technical field [0001] The invention relates to the field of biomedicine, in particular to a gene expression cassette, a lentiviral vector and the application thereof in the treatment of beta thalassemia. Background technique [0002] Beta thalassemia is a recessive inherited blood disorder caused by mutations in the gene encoding beta globin. Symptoms vary in severity in patients with different genotypes of β-thalassemia. The gene that fails to produce any β-globin is called the β0 gene. Symptoms are most severe in patients with two copies of the β0 gene. To survive, patients with transfusion-dependent β-thalassemia (TDT) require lifelong frequent blood transfusions and iron chelation therapy to excrete iron, and TDT patients are at risk of complications such as progressive multiple organ failure due to iron overload. Currently, the curative therapy that can cure TDT is allogeneic hematopoietic stem cell transplantation (HSCT). Risk of complications such as opportunistic ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/867C12N15/12A61K38/17A61K31/7088A61P7/06
CPCC07K14/47C12N15/86A61K38/1709A61K31/7088A61P7/06C12N2740/15043
Inventor 罗敏李光超周兆
Owner GUANGZHOU BIO GENE TECH CO LTD