Scutellariae radix flavone methoxytransferase gene, and recombinant vector and application thereof
A kind of technology of scutellaria flavonoid methoxyl group and scutellarin flavonoid methoxyl group, which is applied in the field of scutellaria flavonoid methoxytransferase gene and its recombinant vector
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] This embodiment is the construction of the cloned yeast expression vector of Scutellaria baicalensis flavone methoxytransferase genes SbFOMT3, SbFOMT5 and SbFOMT6 genes. The specific construction process is as follows:
[0037] (1) Design and synthesis of primers for SbFOMT3, SbFOMT5 and SbFOMT6 genes
[0038] Firstly, the transcriptome of Scutellaria baicalensis was deeply sequenced, and then compared with the methoxytransferase sequences of related species reported in Genbank of Labiatae plants, some of the sequences with coding protein similarity >50% were selected. The relevant gene sequences in Scutellaria baicalensis were obtained, and full-length primers were designed using primer premier 5.0, and Gateway recombination sites were added to the primers of SbFOMT3, SbFOMT5, and SbFOMT6 (Gateway is underlined).
[0039] SbFOMT3-F: GGGGACAAGTTTGTACAAAAAAGCAGGCTTC ATGGGCTCAACAACTAAGAGTG (SEQ ID No. 7);
[0040] SbFOMT3-R: GGGGACCACTTTGTACAAGAAAGCTGGGTT TCATTTGAGCAAC...
Embodiment 2
[0060] In this example, the protein functions of Scutellaria baicalensis SbFOMT3, SbFOMT5 and SbFOMT6 genes were verified in the yeast system. The specific verification process and results are as follows:
[0061] Express the proteins of Scutellaria baicalensis SbFOMT3, SbFOMT5 and SbFOMT6 genes in yeast: the yeast expression vectors pAgl423-SbFOMT3, pAgl423-SbFOMT5 and pAgl423-SbFOMT6 are transformed into Saccharomyces cerevisiae BY4742 strain by chemical transformation method to obtain the yeast strain containing the target gene, At the same time, the empty plasmid containing pAgl423 was transformed as a negative control, and grown in SD solid medium containing glucose and lacking histidine (His) at 28°C for 24-48h.
[0062] Then pick a single clone and grow in 10mL SD liquid medium containing glucose and lacking His at 28°C and 200rpm for 24h to OD 600 Reach 2-3. Collect the thalline, and wash off the glucose in the thalline with sterile water. The bacteria were resuspend...
Embodiment 3
[0067] This example is to verify the synergistic effect of Scutellaria baicalensis SbFOMT3, SbFOMT5 and SbFOMT6 genes and SbPFOMT5 genes in the yeast system. The specific verification process and results are as follows:
[0068] Expression in yeast combined expression of SbFOMT3+SbPFOMT5, SbFOMT5+SbPFOMT5 and SbFOMT6+SbPFOMT5 proteins:
[0069] The yeast expression vectors pAgl423-SbFOMT3+pYES-dest52-SbPFOMT5, pAgl423-SbFOMT5+pYES-dest52-SbPFOMT5, pAgl423-SbFOMT6+pYES-dest52-SbPFOMT5 were transformed into Saccharomyces cerevisiae WAT11 strain by chemical transformation method to obtain At the same time, transform the empty plasmid containing pAgl423+pYES-dest52 as a negative control, and grow in SD solid medium containing glucose and lacking His and Ura at 28°C for 24-48h.
[0070] Then pick a single clone and grow in 10mL SD liquid medium containing glucose and lacking His+Ura at 28°C and 200rpm for 24h to OD 600 Reach 2-3. Collect the thalline, and wash off the glucose in ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



