Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Scutellariae radix flavone methoxytransferase gene, and recombinant vector and application thereof

A kind of technology of scutellaria flavonoid methoxyl group and scutellarin flavonoid methoxyl group, which is applied in the field of scutellaria flavonoid methoxytransferase gene and its recombinant vector

Active Publication Date: 2021-12-03
SHANGHAI CHENSHAN BOTANICAL GARDEN
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are few reports about cloning from the plant Scutellaria baicalensis to encode genes involved in the synthesis pathway of scutellariae flavone I and elastin I and flavones with similar structures.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Scutellariae radix flavone methoxytransferase gene, and recombinant vector and application thereof
  • Scutellariae radix flavone methoxytransferase gene, and recombinant vector and application thereof
  • Scutellariae radix flavone methoxytransferase gene, and recombinant vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] This embodiment is the construction of the cloned yeast expression vector of Scutellaria baicalensis flavone methoxytransferase genes SbFOMT3, SbFOMT5 and SbFOMT6 genes. The specific construction process is as follows:

[0037] (1) Design and synthesis of primers for SbFOMT3, SbFOMT5 and SbFOMT6 genes

[0038] Firstly, the transcriptome of Scutellaria baicalensis was deeply sequenced, and then compared with the methoxytransferase sequences of related species reported in Genbank of Labiatae plants, some of the sequences with coding protein similarity >50% were selected. The relevant gene sequences in Scutellaria baicalensis were obtained, and full-length primers were designed using primer premier 5.0, and Gateway recombination sites were added to the primers of SbFOMT3, SbFOMT5, and SbFOMT6 (Gateway is underlined).

[0039] SbFOMT3-F: GGGGACAAGTTTGTACAAAAAAGCAGGCTTC ATGGGCTCAACAACTAAGAGTG (SEQ ID No. 7);

[0040] SbFOMT3-R: GGGGACCACTTTGTACAAGAAAGCTGGGTT TCATTTGAGCAAC...

Embodiment 2

[0060] In this example, the protein functions of Scutellaria baicalensis SbFOMT3, SbFOMT5 and SbFOMT6 genes were verified in the yeast system. The specific verification process and results are as follows:

[0061] Express the proteins of Scutellaria baicalensis SbFOMT3, SbFOMT5 and SbFOMT6 genes in yeast: the yeast expression vectors pAgl423-SbFOMT3, pAgl423-SbFOMT5 and pAgl423-SbFOMT6 are transformed into Saccharomyces cerevisiae BY4742 strain by chemical transformation method to obtain the yeast strain containing the target gene, At the same time, the empty plasmid containing pAgl423 was transformed as a negative control, and grown in SD solid medium containing glucose and lacking histidine (His) at 28°C for 24-48h.

[0062] Then pick a single clone and grow in 10mL SD liquid medium containing glucose and lacking His at 28°C and 200rpm for 24h to OD 600 Reach 2-3. Collect the thalline, and wash off the glucose in the thalline with sterile water. The bacteria were resuspend...

Embodiment 3

[0067] This example is to verify the synergistic effect of Scutellaria baicalensis SbFOMT3, SbFOMT5 and SbFOMT6 genes and SbPFOMT5 genes in the yeast system. The specific verification process and results are as follows:

[0068] Expression in yeast combined expression of SbFOMT3+SbPFOMT5, SbFOMT5+SbPFOMT5 and SbFOMT6+SbPFOMT5 proteins:

[0069] The yeast expression vectors pAgl423-SbFOMT3+pYES-dest52-SbPFOMT5, pAgl423-SbFOMT5+pYES-dest52-SbPFOMT5, pAgl423-SbFOMT6+pYES-dest52-SbPFOMT5 were transformed into Saccharomyces cerevisiae WAT11 strain by chemical transformation method to obtain At the same time, transform the empty plasmid containing pAgl423+pYES-dest52 as a negative control, and grow in SD solid medium containing glucose and lacking His and Ura at 28°C for 24-48h.

[0070] Then pick a single clone and grow in 10mL SD liquid medium containing glucose and lacking His+Ura at 28°C and 200rpm for 24h to OD 600 Reach 2-3. Collect the thalline, and wash off the glucose in ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a scutellariae radix flavone methoxytransferase gene, and a recombinant vector and application thereof. The scutellariae radix flavone methoxytransferase gene comprises at least one of SbFOMT3, SbFOMT5 and SbFOMT6 genes, wherein the sequence of the SbFOMT3 gene is as shown in SEQ ID No.1, the sequence of the SbFOMT5 gene is as shown in SEQ ID No.3, and the sequence of the SbFOMT6 gene is as shown in SEQ ID No.5. According to the invention, three genes of SbFOMT3, SbFOMT5 and SbFOMT6, which are coded to participate in a methylation synthesis route of oroxylin, 7-methoxy baicalein and flavones with similar structures, are cloned from a labiatae scutellariae medicinal plant scutellariae radix for the first time, and are gene sequences derived from flavones 7-site and 6-site oxygen methyltransferase of the scutellariae radix. Enzyme encoded by the genes can participate in biosynthesis of the oroxylin and the 7-methoxy baicalein and catalyze the oxygen methylation reaction of flavonoid substances with similar structures, scutellariae radix flavone I and baicalein I can be synthesized under the synergistic effect of PFOMT, and a basis is provided for production of effective active substances.

Description

technical field [0001] The invention relates to the technical fields of plant molecular biotechnology and genetic engineering, in particular to a Scutellaria baicalensis flavone methoxytransferase gene and its recombinant vector and application. Background technique [0002] Scutellaria baicalensis is a perennial herbaceous plant of the genus Scutellaria baicalensis in the Labiatae family. It has been used as a traditional medicinal plant for two thousand years; it is mainly used to treat upper respiratory tract infections, lung-heat cough, damp-heat jaundice, pneumonia, and dysentery. Modern medical research shows that the main active ingredients in Scutellaria baicalensis are the methylated flavonoids abundantly present in the roots: wogonin, baicalein I and elastin I. According to animal cell experiments, it is found that the above substances have certain anticancer activity. [0003] With the extensive and in-depth research on the pharmacological activity of Scutellaria...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/54C12N9/10C12P17/06
CPCC12N9/1007C12P17/06Y02A50/30
Inventor 赵清崔孟颖柳洁方誉民凯西·马丁
Owner SHANGHAI CHENSHAN BOTANICAL GARDEN
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com