Nucleic acid medicine for diabetic cardiomyopathy and application thereof

A technology for diabetic cardiomyopathy and nucleic acid drugs, which is applied in the field of genetic engineering and the treatment of cardiovascular and cerebrovascular diseases, can solve the problems of no literature on the role of cardiac circRNA, and achieve the effects of inhibiting cardiomyocyte pyroptosis, high affinity, and easy synthesis and modification.

Active Publication Date: 2022-01-28
WUHAN UNIV OF SCI & TECH
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no literature reporting the role of cardiac circRNA expression in the pathogenesis and progression of diabetic cardiomyopathy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid medicine for diabetic cardiomyopathy and application thereof
  • Nucleic acid medicine for diabetic cardiomyopathy and application thereof
  • Nucleic acid medicine for diabetic cardiomyopathy and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Effect of DICAR overexpression on alloxan-induced diabetic mice

[0031] In order to verify the effect of DICAR on diabetic cardiomyopathy, alloxan was used to construct a diabetic mouse model, and DICAR was overexpressed, and the changes in cardiac function and tissue of mice before and after overexpression were observed, as follows:

[0032] 1. Modeling and grouping

[0033] DICAR was overexpressed in mice using CRISPR / Cas9 gene editing technology to obtain DICAR-Tg mice (using CRISPR / Cas9 gene editing technology, the mm9-circ-008009 gene overexpression system was established, and the mm9-circ-008009 overexpression system was established db / db mice) to explore the protective effect of DICAR on DCM, the specific method is:

[0034] Take 20 wild-type and DICAR-Tg C57BL / 6 mice, SPF grade, half male and half female, body weight (20±2) g, high-fat diet for 1 month, fasting for 12 hours before modeling, wild-type and DICAR -Tg group randomly selected 10 mice as ...

Embodiment 2

[0050] The discovery of embodiment 2 nucleic acid drugs

[0051] According to the results of Example 1, DICAR plays an important role in diabetic cardiomyopathy, and human DICAR: has-circ-0131202 and mouse DICAR: mm9-circ-008009 are important DICARs. On this basis, their structures Analyzes are used to prepare small molecule nucleic acid drugs that are easier to synthesize.

[0052] 1. When the software recognized the second structure of DICAR, the connected domain showed a specific finger shape (such as image 3 shown). Therefore, we speculated whether DICAR could directly regulate protein activation. There may be an interaction between the DICAR domain and the protein. To explore the mechanism of DICAR in cardiac dysfunction, ChIRP mass spectrometry (ChIRP-MS) was used to identify binding proteins interacting with DICAR. Biotin-labeled DICAR junction site probes were purified and subjected to circRNA pull-down analysis by incubation with primary mouse cardiomyocyte (MCM)...

Embodiment 3

[0057] Example 3 Preparation of Nucleic Acid Drugs and Its Effect on Diabetic Cardiomyopathy

[0058] 1, according to embodiment 2, design corresponding nucleic acid drug, are respectively:

[0059] hDICAR-JD:

[0060] CAACCTCCGGGGCCACAATAGCGAGATTTGTAAGACTCCAGGGCCTCCCAG (as shown in SEQ ID NO.1)

[0061] mDICAR-JD:

[0062] CAACCTGCGAGGCCACAACAGTGAGAGTTGTAAGAGTCCATCCAGGACCTTC (as shown in SEQ ID NO.2)

[0063] Manufactured by Shanghai Sangong.

[0064] 2. Nucleic acid drug treatment of human cardiomyocytes (HCM) and mouse cardiomyocytes (MCM)

[0065] ①Human cardiomyocytes (HCM) were inoculated in a six-well plate, and grouped into control, AGEs, AGEs+hDICAR-JD(10nM), hDICAR-JD(10nM), hAGEs+DICAR-JD(20nM), hDICAR-JD(20nM ), AGEs+hDICAR-JD (50nM), hDICAR-JD (50nM). Firstly, different concentrations of nucleic acid drugs were added to treat for 24 hours. Then AGEs were added. Before AGEs treatment, the cardiomyocytes were replaced with serum-free high-glucose DMEM medium,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a nucleic acid medicine for diabetic cardiomyopathy and application of the nucleic acid medicine. The nucleic acid medicine is prepared from hDICAR-JD and / or mDICAR-JD, the nucleotide sequence of the hDICAR-JD is as shown in SEQ ID NO. 1 in a sequence table; and the nucleotide sequence of the mDICAR-JD is as shown in SEQ ID NO. 2 in the sequence table. According to the application disclosed by the invention, firstly, a diabetic mouse model is constructed, and research finds that the expressed DICAR has a remarkable improvement effect on diabetic cardiomyopathy; and a diabetic cardiac muscle cell model is further utilized, it is found that after being administered by means of human has-circ-0131202 and mouse mm9-circ-008009, namely, hDICAR-JD and mDICAR-JD, cardiac muscle pyroptosis induced by AGEs can be obviously inhibited, and the nucleic acid medicine has the advantages of being high in affinity, high in specificity, easy to synthesize and modify, flexible in design and the like. Therefore, help is provided for treatment of diabetic cardiomyopathy and development and application of nucleic acid drugs, and an important basis is provided for clinical treatment of diabetic cardiomyopathy by using circRNA.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering and treatment of cardiovascular and cerebrovascular diseases, and in particular relates to a nucleic acid drug for diabetic cardiomyopathy and its application. Background technique [0002] Diabetic cardiomyopathy (diabetic cardiomyopathy, DCM) is a special type of heart disease that occurs in diabetic patients and cannot be used for hypertensive heart disease, coronary atherosclerotic heart disease, heart valve disease and other heart diseases to explain specific cardiomyopathy. That is, even in the absence of diseases such as hypertension and ischemic heart disease in diabetic patients, changes in heart structure and function may still occur. Diabetic cardiomyopathy usually presents as early manifestations of left ventricular hypertrophy and diastolic dysfunction, and eventually can induce heart failure, arrhythmia, and cardiogenic shock, and even sudden death in severe cases. The ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K48/00A61P9/00A61P3/10
CPCA61K48/005A61P9/00A61P3/10
Inventor袁琼孙芸薇沈美花张春祥詹琳周乾毅
OwnerWUHAN UNIV OF SCI & TECH