Application of ST3GAL6-AS1 gene, specific primer pair and kit
A ST3GAL6-AS1, 1.ST3GAL6-AS1 technology, applied in the application of ST3GAL6-AS1 gene and the field of specific primer pairs and kits, can solve the problems of non-secretion, variation, and difficulty in identifying benign and malignant plasma cells, and achieve High sensitivity and high specificity effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] Synthetic specific primer pairs:
[0053] Primer pair A specific for the ST3GAL6-AS1 gene (used to amplify this gene in patient samples):
[0054] Upstream primer ST3GAL6-AS1-F: 5'-GCAGCACAGAATCCTGACAA-3' (SEQ ID No.1);
[0055] Downstream primer ST3GAL6-AS1-R: 5'-GCCAGCATTTTGGTAAGAGC-3' (SEQ ID No. 2).
[0056] Specific primer pair B for the ABL gene (internal reference gene) (internal reference gene for amplifying the internal reference control plasmid):
[0057] Upstream primer ABL-F: 5'-TGGAGATAACACTCTAAAGCATAACTAAAGGT-3' (SEQ ID No.3);
[0058] Downstream primer ABL-R: 5'-GATGTAGTTGCTTGGGACCCA-3' (SEQ ID No.4).
[0059] A pair of specific primers targeting the ABL gene was synthesized by reference (Gabert J, Beillard E, van derVelden VH, et al. Leukemia. 2003, 17: 2318-2357.)
[0060] The sequence of the ST3GAL6-AS1 gene is as follows:
[0061] GCCAGTTGCACGGTGGCCGCCCCCAAATTCGAGGAGGAAGGTGCAAAGTGGTGGGAGGCTGCGGGTCTCC
[0062] CGGAGGGTGAGGCGTTGGGGACCAGGCGGGAGCACA...
Embodiment 2
[0074] Preparation of relevant plasmids:
[0075] 1. Preparation of positive control plasmid (plasmid containing ST3GAL6-AS1 gene fragment)
[0076] The whole gene synthesis ST3GAL6-AS1 gene DNA was used as a template for PCR amplification, and the nucleotide sequence of the amplified product is shown in SEQ ID No.7 below. The PCR product was recovered (DNA Gel Recovery Kit, DONGSHENG BIOTECH), and then digested with GV367 and AgeI / NheI respectively. After recovering the digestion product (DNA Gel Recovery Kit, DONGSHENG BIOTECH), the target fragment was ligated with the vector (ClonExpress MultiS One Step Cloning Ki recombinase was purchased from Novozyme, Cat. No.: C113-01). The recombinant plasmid was transformed into Escherichia coli DH5α (Tiangen Biochemical Company, Cat. No.: CD101-02) competent, the positive clones were screened, the plasmid was extracted and purified, and then sequenced. The results showed that a positive control plasmid was obtained.
[0077] Design...
Embodiment 3
[0093] Sensitivity testing of the kit
[0094] The kit consists of the following components: the specific primer pair A for the ST3GAL6-AS1 gene prepared in Example 1; the positive control plasmid prepared in Example 2.
[0095] 2. Sensitivity testing of the kit
[0096] The positive control plasmid was serially diluted 10 times to contain 10 5 、10 4 、10 3 、10 2 copies of the ST3GAL6-AS1 gene fragment. RT-qPCR was performed on a fluorescent real-time quantitative PCR instrument (7500-FAST, ABI, USA).
[0097] PCR reaction system (20 μl): 0.5 μM of the upstream primer shown in Example 2, 0.5 μM of the downstream primer shown in Example 2, 10 μl of 2×TaqMan mix (TOYOBO, Japan), 2 μl of plasmid; 7 μl of deionized water. PCR reaction conditions: 95°C for 5min; 95°C for 10sec, 60°C for 30sec, 39 cycles; 95°C for 15sec, 60°C for 1min.
[0098] positive control plasmid 10 5 、10 4 、10 3 、10 2 For the RQ-PCR fluorescence curve of each copy, see figure 1 and figure 2 , the...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



