Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of ST3GAL6-AS1 gene, specific primer pair and kit

A ST3GAL6-AS1, 1.ST3GAL6-AS1 technology, applied in the application of ST3GAL6-AS1 gene and the field of specific primer pairs and kits, can solve the problems of non-secretion, variation, and difficulty in identifying benign and malignant plasma cells, and achieve High sensitivity and high specificity effect

Pending Publication Date: 2022-01-28
SICHUAN ACADEMY OF MEDICAL SCI SICHUAN PROVINCIAL PEOPLES HOSPITAL
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the commonly used MRD detection method is to collect bone marrow samples for cell morphology detection and flow cytometry immunotyping, but there are deficiencies: ① MM has unique tissue distribution characteristics, that is, the degree of infiltration and proliferation of tumor cells in the marrow is different. Focal distribution, often requires multiple punctures to detect a positive result, and the variation between multiple test results is large
Cell morphology is highly subjective, making it difficult to differentiate benign and malignant plasma cells
And the number of myeloma cells decreased sharply after chemotherapy, even if the number of manually sorted cells exceeds the number of daily detection, it is still difficult to accurately count the number of tumor cells
③ It is difficult to unify the detection scheme and monitoring indicators of flow cytometry due to the large differences in the state of instruments and the technical level of personnel in each laboratory
However, ST3GAL6 is a non-secreted protein, which is mainly distributed in cells and can hardly be secreted into plasma, so non-invasive detection cannot be realized
[0005] In the prior art, there are few studies on the detection indicators of MM and MRD. Therefore, it is necessary to further search and study the related genes that can be used as markers in MM and MRD to realize the non-invasive detection of MM and MRD.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of ST3GAL6-AS1 gene, specific primer pair and kit
  • Application of ST3GAL6-AS1 gene, specific primer pair and kit
  • Application of ST3GAL6-AS1 gene, specific primer pair and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Synthetic specific primer pairs:

[0053] Primer pair A specific for the ST3GAL6-AS1 gene (used to amplify this gene in patient samples):

[0054] Upstream primer ST3GAL6-AS1-F: 5'-GCAGCACAGAATCCTGACAA-3' (SEQ ID No.1);

[0055] Downstream primer ST3GAL6-AS1-R: 5'-GCCAGCATTTTGGTAAGAGC-3' (SEQ ID No. 2).

[0056] Specific primer pair B for the ABL gene (internal reference gene) (internal reference gene for amplifying the internal reference control plasmid):

[0057] Upstream primer ABL-F: 5'-TGGAGATAACACTCTAAAGCATAACTAAAGGT-3' (SEQ ID No.3);

[0058] Downstream primer ABL-R: 5'-GATGTAGTTGCTTGGGACCCA-3' (SEQ ID No.4).

[0059] A pair of specific primers targeting the ABL gene was synthesized by reference (Gabert J, Beillard E, van derVelden VH, et al. Leukemia. 2003, 17: 2318-2357.)

[0060] The sequence of the ST3GAL6-AS1 gene is as follows:

[0061] GCCAGTTGCACGGTGGCCGCCCCCAAATTCGAGGAGGAAGGTGCAAAGTGGTGGGAGGCTGCGGGTCTCC

[0062] CGGAGGGTGAGGCGTTGGGGACCAGGCGGGAGCACA...

Embodiment 2

[0074] Preparation of relevant plasmids:

[0075] 1. Preparation of positive control plasmid (plasmid containing ST3GAL6-AS1 gene fragment)

[0076] The whole gene synthesis ST3GAL6-AS1 gene DNA was used as a template for PCR amplification, and the nucleotide sequence of the amplified product is shown in SEQ ID No.7 below. The PCR product was recovered (DNA Gel Recovery Kit, DONGSHENG BIOTECH), and then digested with GV367 and AgeI / NheI respectively. After recovering the digestion product (DNA Gel Recovery Kit, DONGSHENG BIOTECH), the target fragment was ligated with the vector (ClonExpress MultiS One Step Cloning Ki recombinase was purchased from Novozyme, Cat. No.: C113-01). The recombinant plasmid was transformed into Escherichia coli DH5α (Tiangen Biochemical Company, Cat. No.: CD101-02) competent, the positive clones were screened, the plasmid was extracted and purified, and then sequenced. The results showed that a positive control plasmid was obtained.

[0077] Design...

Embodiment 3

[0093] Sensitivity testing of the kit

[0094] The kit consists of the following components: the specific primer pair A for the ST3GAL6-AS1 gene prepared in Example 1; the positive control plasmid prepared in Example 2.

[0095] 2. Sensitivity testing of the kit

[0096] The positive control plasmid was serially diluted 10 times to contain 10 5 、10 4 、10 3 、10 2 copies of the ST3GAL6-AS1 gene fragment. RT-qPCR was performed on a fluorescent real-time quantitative PCR instrument (7500-FAST, ABI, USA).

[0097] PCR reaction system (20 μl): 0.5 μM of the upstream primer shown in Example 2, 0.5 μM of the downstream primer shown in Example 2, 10 μl of 2×TaqMan mix (TOYOBO, Japan), 2 μl of plasmid; 7 μl of deionized water. PCR reaction conditions: 95°C for 5min; 95°C for 10sec, 60°C for 30sec, 39 cycles; 95°C for 15sec, 60°C for 1min.

[0098] positive control plasmid 10 5 、10 4 、10 3 、10 2 For the RQ-PCR fluorescence curve of each copy, see figure 1 and figure 2 , the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of an ST3GAL6-AS1 gene as well as a specific primer pair and a kit, and the specific primer pair aiming at the ST3GAL6-AS1 gene comprises an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is as shown in SEQ ID No. 1; and the nucleotide sequence of the downstream primer is as shown in SEQ ID No.2. The kit comprises a specific primer pair aiming at the ST3GAL6-AS1 gene. The ST3GAL6-AS1 gene is used as a detection marker of MM and MRD for the first time and is used for detecting multiple myeloma and multiple myeloma residues, high sensitivity and high specificity are achieved, and noninvasive detection can be achieved; and the kit disclosed by the invention not only can be applied to qualitative detection of MM and MRD, but also can be used for quantitatively determining the invasion and migration capabilities of tumor cells in the body of a patient through comparison with a reference gene.

Description

technical field [0001] The invention relates to the technical field of multiple myeloma detection, in particular to the application of the ST3GAL6-AS1 gene, a pair of specific primers and a kit. Background technique [0002] Multiple myeloma (multiple myeloma, MM) accounts for 10% of hematologic malignancies and 1% of all malignancies. MM is a malignant clonal tumor of plasma cells. Although new drugs such as lenalidomide and bortezomib have shown remarkable curative effects in recent years, it is still incurable, and all patients will eventually relapse. The main reason is that patients still have minimal residual disease (MRD) after conventional treatment, and MRD is considered to be the source of recurrence. MRD directly guides treatment and judges prognosis, so MRD needs to be monitored. At present, the commonly used MRD detection method is to collect bone marrow samples for cell morphology detection and flow cytometry immunotyping, but there are deficiencies: ① MM has...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886C12N15/11
CPCC12Q1/6886C12Q2600/166C12Q2600/112C12Q2600/118C12Q2600/158
Inventor 钟凌戴超罗澜解春宝杨季云周玉姜涛
Owner SICHUAN ACADEMY OF MEDICAL SCI SICHUAN PROVINCIAL PEOPLES HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products