Double-target SARS-CoV-2 virus nucleic acid detection primer group, application and fluorescent kit
A technology for detecting primers and viral nucleic acids, applied in DNA/RNA fragments, recombinant DNA technology, biochemical equipment and methods, etc., can solve problems such as hidden safety hazards, complex judgment process, secondary pollution, etc., to prevent secondary pollution. , high sensitivity, ensure the effect of safety
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0055] The embodiment of the present invention provides a dual-target SARS-CoV-2 viral nucleic acid detection primer set, including an N gene primer set and an S gene primer set;
[0056] The N gene primer set includes a pair of outer primers F3-1 and B3-1, a pair of inner primers FIP-1 and BIP-1, and a pair of loop primers LF-1 and LB-1;
[0057] The nucleotide sequence SEQ ID No of said F3-1, B3-1, FIP-1, BIP-1, LF-1, LB-1 is as follows:
[0058] F3-1: CTAGGTTTCAAACTTTACTTGC;
[0059] B3-1: CCTTTTTCTACAGTGAAGGATT;
[0060] FIP-1: ACCCACATAATAAGCTGCAGCA-GTTATTTGACTCCTGGTGATT;
[0061] BIP-1: ATGAAAATGGAACCATTACAGATGC-CAACGTACACTTTGTTTCTGA;
[0062] LF-1: CCAGCTGTCCAACCTGAAGA;
[0063] LB-1: ACTGTGCACTTGACCCTCTC.
Embodiment 2
[0065] The embodiment of the present invention provides a dual-target SARS-CoV-2 viral nucleic acid detection primer set, including an N gene primer set and an S gene primer set;
[0066] The S gene primer set includes a pair of outer primers F3-2 and B3-2, a pair of inner primers FIP-2 and BIP-2, and a pair of loop primers LF-2 and LB-2;
[0067] The nucleotide sequence SEQ ID No of said F3-2, B3-2, FIP-2, BIP-2, LF-2, LB-2 is as follows:
[0068] F3-2: CACCCGCAATCCTGCTAAC;
[0069] B3-2: CCAGCCATTCTAGCAGGAGA;
[0070] FIP-2: TGCTCCCTTCTGCGTAGAAGC-GCTGCAATCGTGCTACAACT;
[0071] BIP-2: GGCGGCAGTCAAGCCTCTTC-CCTACTGCTGCCTGGAGTT;
[0072] LF-2: TGGCAATGTTGTTCCTTGAGG;
[0073] LB-2: ATCACGTAGTCGCAACAGTTC.
Embodiment 3
[0075] The embodiment of the present invention provides a one-pot RT-LAMP fluorescence detection kit for detecting SARS-CoV-2 virus. The kit is composed of reaction premix A, reaction premix B, positive quality control, and negative control. Specifically, using the kit of this embodiment, the 25 μL reaction system contains the following materials: 5 μL of the sample to be tested, 3 μL of the reaction master mix A (4U of Bst DNA large fragment polymerase, 8U of AMV reverse transcriptase, 0.5 μL of SYBR green I fluorescent dye (1000×), 17 μL reaction premix B (primer set 2.8 μL, dNTP 1.0 mM, betaine 1.2 mM, magnesium sulfate 12 mM, volume fraction 12% formamide solution, DEPC water to make up to 17 μL).
[0076] The primer set is the dual-target SARS-CoV-2 viral nucleic acid detection primer set described in Example 1 and Example 2, and the nucleotide sequence is as shown in SEQ ID No1-12. Wherein, the concentration ratio of the N gene primer set and the S gene primer set is 1:1...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



