Unlock instant, AI-driven research and patent intelligence for your innovation.

Banana fruit cold tolerance transcription factor gene function verification method

A transcription factor and gene function technology, applied in the field of genetic engineering, can solve problems such as complexity, difficult control of fruit regulation, and inability to verify functions, achieving good evaluation results and obvious technical effects

Pending Publication Date: 2022-03-01
ZHEJIANG WANLI UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the internal regulation of the fruit is difficult to control and extremely complex, and the existing technology cannot perform functional verification on the NAC transcription factor gene that regulates the cold tolerance of banana fruit

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Banana fruit cold tolerance transcription factor gene function verification method
  • Banana fruit cold tolerance transcription factor gene function verification method
  • Banana fruit cold tolerance transcription factor gene function verification method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1N

[0022] Example 1NAC transcription factor

[0023] Two NAC transcription factors MaNAC25 and MaNAC28 with transcription activation activity were obtained from banana fruit. The coding region sequence of MaNAC25 is shown in SEQ ID NO.1, and the coding region sequence of MaNAC28 is shown in SEQ ID NO.2.

Embodiment 2

[0024] Embodiment 2 tomato genetic transformation

[0025] 1. Recombinant vector cloning

[0026] The coding region sequences of MaNAC25 and MaNAC28 were cloned into the plant binary vector pLP100-35S carrying a β-glucuronidase reporter gene, and the sequence of pLP100-35S is shown in SEQ ID NO.3. MaNAC25 overexpression vector forward primer sequence is TTTGGAGAGGACAGGGTACCCGGG ATGGCTGATGTCTCCGTGGTCA (SEQ ID NO.4), the reverse primer sequence is GGTCGACTCTAGAGGATCCCCGGG TCAGTACTGCCAGAAGTTTCTCAG (SEQ ID NO. 5). MaNAC28 overexpression vector, the forward primer sequence is TTTGGAGAGGACAGGGTACCCGGG ATGGAGGAGAGGAGGGAGAAGA (SEQID NO.6), the reverse primer sequence is GGTCGACTCTAGAGGATCCCCGGG CTAGGGGTATTGGCAACAGGAG (SEQ ID NO. 7). The overexpression vectors LB-35S:GUS-35S:MaNAC25-RB and LB-35S:GUS-35S:MaNAC28-RB were generated.

[0027] 2. Agrobacterium transformation and infection

[0028] The recombinant vector was transformed into Micro-Tom tomato fruit by Agrobacterium...

Embodiment 3

[0032] Example 3 Functional Verification of Transcription Factors

[0033] Independently transformed MaNAC25 and MaNAC28 overexpression lines were used as experimental fruits, and wild-type tomato fruits (WT) were used as control fruits.

[0034] 1. Store the experimental fruit and the control fruit at 4°C, observe the appearance properties of the experimental fruit and the control fruit at 20d, 33d, and 40d, and the results are as follows: figure 1 shown. The results showed that, compared with the harvested tomato fruits, overexpressed MaNAC25 and MaNAC28 tomato fruits showed severe shrinkage and chilling damage after 20 days of low temperature storage, while WT fruits maintained a good appearance. With the prolongation of low-temperature storage, the symptoms of chilling injury in transgenic tomato fruits gradually increased, while WT fruits showed slight chilling injury traits after 33 days of low-temperature storage. The results showed that the NAC transcription factors...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a banana fruit cold tolerance transcription factor gene function verification method. The method comprises the following steps: (1) acquiring a transcription factor; (2) genetic transformation of tomatoes; and (3) verifying the function of the transcription factor: taking independently transformed MaNAC25 and MaNAC28 overexpression strains as experimental fruits, taking wild tomato fruits as control fruits, storing the experimental fruits and the control fruits at low temperature, evaluating and comparing the cold injury degree of the experimental fruits and the control fruits, and verifying the regulation effect of the NAC transcription factor on the cold resistance of the banana fruits. The transgenic tomato fruits are used for functional verification from internal regulation and control of banana fruit cold damage, the research depth and breadth are achieved, and a scientific basis and a new material are provided for research directions of good fruit variety breeding, fruit cold damage control technology optimization and the like.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a method for verifying the function of a banana fruit cold tolerance transcription factor gene. Background technique [0002] Banana is an important fruit in the tropics and subtropics. It is loved by people because of its high yield, sweet flesh and rich nutrition. Banana is a typical respiratory climacteric fruit. The respiration process is accelerated at room temperature after harvest, and ethylene is released rapidly. The ethylene gas produced further accelerates the ripening of banana fruit, which in turn promotes the increase of soluble solid content, and the banana fruit gradually softens. , which will promote the infection of pathogenic microorganisms, and eventually lead to diseases of banana fruits, which seriously affects the shelf life of banana fruits and is also a limiting factor for post-harvest storage and preservation of banana fruits. However, low-t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/82C12N15/84A01H5/00A01H6/82A01H4/00
CPCC07K14/415C12N15/8273C12N15/8205A01H4/008
Inventor 宋春波龚泽皓武孟波
Owner ZHEJIANG WANLI UNIV