Banana fruit cold tolerance transcription factor gene function verification method
A transcription factor and gene function technology, applied in the field of genetic engineering, can solve problems such as complexity, difficult control of fruit regulation, and inability to verify functions, achieving good evaluation results and obvious technical effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1N
[0022] Example 1NAC transcription factor
[0023] Two NAC transcription factors MaNAC25 and MaNAC28 with transcription activation activity were obtained from banana fruit. The coding region sequence of MaNAC25 is shown in SEQ ID NO.1, and the coding region sequence of MaNAC28 is shown in SEQ ID NO.2.
Embodiment 2
[0024] Embodiment 2 tomato genetic transformation
[0025] 1. Recombinant vector cloning
[0026] The coding region sequences of MaNAC25 and MaNAC28 were cloned into the plant binary vector pLP100-35S carrying a β-glucuronidase reporter gene, and the sequence of pLP100-35S is shown in SEQ ID NO.3. MaNAC25 overexpression vector forward primer sequence is TTTGGAGAGGACAGGGTACCCGGG ATGGCTGATGTCTCCGTGGTCA (SEQ ID NO.4), the reverse primer sequence is GGTCGACTCTAGAGGATCCCCGGG TCAGTACTGCCAGAAGTTTCTCAG (SEQ ID NO. 5). MaNAC28 overexpression vector, the forward primer sequence is TTTGGAGAGGACAGGGTACCCGGG ATGGAGGAGAGGAGGGAGAAGA (SEQID NO.6), the reverse primer sequence is GGTCGACTCTAGAGGATCCCCGGG CTAGGGGTATTGGCAACAGGAG (SEQ ID NO. 7). The overexpression vectors LB-35S:GUS-35S:MaNAC25-RB and LB-35S:GUS-35S:MaNAC28-RB were generated.
[0027] 2. Agrobacterium transformation and infection
[0028] The recombinant vector was transformed into Micro-Tom tomato fruit by Agrobacterium...
Embodiment 3
[0032] Example 3 Functional Verification of Transcription Factors
[0033] Independently transformed MaNAC25 and MaNAC28 overexpression lines were used as experimental fruits, and wild-type tomato fruits (WT) were used as control fruits.
[0034] 1. Store the experimental fruit and the control fruit at 4°C, observe the appearance properties of the experimental fruit and the control fruit at 20d, 33d, and 40d, and the results are as follows: figure 1 shown. The results showed that, compared with the harvested tomato fruits, overexpressed MaNAC25 and MaNAC28 tomato fruits showed severe shrinkage and chilling damage after 20 days of low temperature storage, while WT fruits maintained a good appearance. With the prolongation of low-temperature storage, the symptoms of chilling injury in transgenic tomato fruits gradually increased, while WT fruits showed slight chilling injury traits after 33 days of low-temperature storage. The results showed that the NAC transcription factors...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


