Antibody targeting 4-1BB and application thereof

A nanobody and expression vector technology, applied in the field of biomedicine, can solve the problems of low receptor agonistic activity, liver toxicity and fatigue

Pending Publication Date: 2022-03-18
BIOTHEUS INC
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies have shown that Urelumab is a potent activator with good activating activity, but it also has adverse reactions such as liver toxicity and fatigue; while Utomilumab has advantages in safety, but compared with Urelumab, it has no effect on receptor agonist activity. lower

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antibody targeting 4-1BB and application thereof
  • Antibody targeting 4-1BB and application thereof
  • Antibody targeting 4-1BB and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0194] Example 1: Construction of Nano-antibody library

[0195] 1.1 animal immunity

[0196] Mixing 1 mg 4-1bb antigen (purchased from Acrobiosystems) with Freund Adjurators, etc. . After 4 immunization, 50 ml of alpaca peripheral blood was extracted, and lymphocytes were isolated using lymphocyte isolation. Total RNA was extracted with RNA extraction reagent Trizol (purchased from invitrogen). The total CDNA of alpaca was obtained using a cDNA synthesis kit (purchased from Invitrogen).

[0197] 1.2 nanocarbon gene amplification

[0198] The first round of PCR, increasing IgG2, IgG3 sequence from cDNA:

[0199] Table 1. First round PCR primer

[0200] name Sequence (5 'to 3') SEQ ID NO: Upstream primer GtcctggctgctcttctCtacaagg 161 Downstream primer GGTACGTGCTGTGTGAACTGTTCC 162

[0201] The first round of PCR product was subjected to agarose gel electrophoresis, and the fragment of the cutting of 750 bp was used for the second round of VHH sequence am...

Embodiment 2

[0210] Example 2: Screening of 4-1BB Nanobody

[0211] 2.1 people 4-1 bb protein biotinylation

[0212] The amount of double-vapor dissolved person 4-1 bb (purchased from Acrobiosystems) was taken, and the biotin was mixed with the protein solution after dissolving the biotin solution, incubated at 4 ° C for 2 hours. Removal of excess biotin, dehydallol column pretreatment and sample collection operation with dehydrate columns (purchased from thermo).

[0213] 2.2 MACS enrichment can be combined with 4-1 bb specific binding yeast

[0214] The VHH library constructed in Example 2 was seeded in SD-CAA amplification medium (1L SD-CAA amplification medium containing 6.7 g of YNB, 5G casein amino acid, 13.62 g Na) 2 HPO 4 12h 2 O, 7.44G NAH 2 PO 4 In 2% glucose), 30 ° C, 225 rpm was cultured overnight. Appropriate amount of yeast cells, 3000 rpm × 5min centrifugation was removed, and the medium re-suspended yeast cells were induced by SD-CAA and induced overnight. The induced library...

Embodiment 3

[0220] Example 3: Construction and expression of heavy chain antibody fusion proteins

[0221] 3.1 antibody gene constructs a PCDNA3.1 expression vector

[0222]The VHH gene sequence and the human IgG1 (Lala mutation) Fc section were connected to the PCDNA3.1 vector of homologous recombinase (purchased from Vazyme) and ECOR I / NOT I diced PCDNA3.1 vector, according to the product manual. Homologous recombinant productization was transferred to TOP10 sensitive cells, coated ampic resistance plate, and cultured overnight at 37 ° C, and picked monoclonal sequencing.

[0223] 3.2 cell transfection

[0224] EXPICHO TM Expression system kits (purchased from thermo), transfer plasmid into Expi-CHO cells, transfection methods, according to the product specification, cell culture 5 days, collected supernatants using protein A magnetic beads (purchased from Kingsi) sorting method purified Purpose protein. The magnetic bead was added with a suitable volume of binding buffer (PBS + 0.1% Tw...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides an anti-4-1BB nano antibody as well as a derivative and application thereof. In particular, the invention provides a nano antibody for resisting 4-1BB. The anti-4BB nano antibody disclosed by the invention has the advantages that the molecular weight is small; human 4-1BB can be combined, and meanwhile, 4-1BB of cynomolgus monkeys can be crossly combined; t cells need to be activated under the condition of external cross-linking, and the like, so that the nano antibody has excellent anti-tumor activity and safety at the same time. The invention further provides a nano antibody capable of being combined with the CRD4 region of the 4-1BB protein, and the region is a brand new antibody binding site.

Description

Technical field [0001] The present invention belongs to the field of biomedicine, and more particularly to antibodies targeted 4-1 bb and its application thereof. Background technique [0002] Tumor necrosis factor receptor superfamily (4-1bb) is also named CD137, or TNFRF9, is one of the members of the TNF receptor family. 4-1BB is a reading frame containing 255 amino acids (NCBI: NP_001552), a transmembrane protein having a N-terminal signal peptide containing 17 amino acids, an extracellular region of 169 amino acids, and a transmembrane region of 27 amino acids. 42 amino acids of C-terminate interior region. 4-1BB molecules are mainly expressed in activated T cells, NK cells, regulatory T cells, dendritic cells, monocytes, neutrophils and eosinophils, have reported 4-1bb. . [0003] During the activation of T cells, 4-1 bb molecules can provide a co-stimuli signal. When the T cell receptor is in contact with the antigen, the expression of 4-1bb can be increased, 4-1bb and the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/28C07K19/00C12N15/13C12N15/62A61K47/68A61K47/64A61P35/00G01N33/68
CPCC07K16/2878A61K47/6801A61K47/64A61P35/00G01N33/6872C07K2317/569C07K2317/92C07K2317/24C07K2317/76C07K2319/30G01N2333/70578A61K47/68C07K16/00C07K16/28C07K19/00G01N33/68C07K16/30G01N33/531G01N33/574A61K47/6803A61K2039/505
Inventor 翟天航缪小牛徐祎凤王超曾竣玮
Owner BIOTHEUS INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap