Antibody targeting 4-1BB and application thereof
A nanobody and expression vector technology, applied in the field of biomedicine, can solve the problems of low receptor agonistic activity, liver toxicity and fatigue
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0194] Example 1: Construction of Nano-antibody library
[0195] 1.1 animal immunity
[0196] Mixing 1 mg 4-1bb antigen (purchased from Acrobiosystems) with Freund Adjurators, etc. . After 4 immunization, 50 ml of alpaca peripheral blood was extracted, and lymphocytes were isolated using lymphocyte isolation. Total RNA was extracted with RNA extraction reagent Trizol (purchased from invitrogen). The total CDNA of alpaca was obtained using a cDNA synthesis kit (purchased from Invitrogen).
[0197] 1.2 nanocarbon gene amplification
[0198] The first round of PCR, increasing IgG2, IgG3 sequence from cDNA:
[0199] Table 1. First round PCR primer
[0200] name Sequence (5 'to 3') SEQ ID NO: Upstream primer GtcctggctgctcttctCtacaagg 161 Downstream primer GGTACGTGCTGTGTGAACTGTTCC 162
[0201] The first round of PCR product was subjected to agarose gel electrophoresis, and the fragment of the cutting of 750 bp was used for the second round of VHH sequence am...
Embodiment 2
[0210] Example 2: Screening of 4-1BB Nanobody
[0211] 2.1 people 4-1 bb protein biotinylation
[0212] The amount of double-vapor dissolved person 4-1 bb (purchased from Acrobiosystems) was taken, and the biotin was mixed with the protein solution after dissolving the biotin solution, incubated at 4 ° C for 2 hours. Removal of excess biotin, dehydallol column pretreatment and sample collection operation with dehydrate columns (purchased from thermo).
[0213] 2.2 MACS enrichment can be combined with 4-1 bb specific binding yeast
[0214] The VHH library constructed in Example 2 was seeded in SD-CAA amplification medium (1L SD-CAA amplification medium containing 6.7 g of YNB, 5G casein amino acid, 13.62 g Na) 2 HPO 4 12h 2 O, 7.44G NAH 2 PO 4 In 2% glucose), 30 ° C, 225 rpm was cultured overnight. Appropriate amount of yeast cells, 3000 rpm × 5min centrifugation was removed, and the medium re-suspended yeast cells were induced by SD-CAA and induced overnight. The induced library...
Embodiment 3
[0220] Example 3: Construction and expression of heavy chain antibody fusion proteins
[0221] 3.1 antibody gene constructs a PCDNA3.1 expression vector
[0222]The VHH gene sequence and the human IgG1 (Lala mutation) Fc section were connected to the PCDNA3.1 vector of homologous recombinase (purchased from Vazyme) and ECOR I / NOT I diced PCDNA3.1 vector, according to the product manual. Homologous recombinant productization was transferred to TOP10 sensitive cells, coated ampic resistance plate, and cultured overnight at 37 ° C, and picked monoclonal sequencing.
[0223] 3.2 cell transfection
[0224] EXPICHO TM Expression system kits (purchased from thermo), transfer plasmid into Expi-CHO cells, transfection methods, according to the product specification, cell culture 5 days, collected supernatants using protein A magnetic beads (purchased from Kingsi) sorting method purified Purpose protein. The magnetic bead was added with a suitable volume of binding buffer (PBS + 0.1% Tw...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com