Method for regulating and controlling ability of protein Lb630 containing WxL structural domain to bind insoluble cellulose and xylan
A technology of cellulose and structural domains, applied in the field of agricultural biology, can solve problems such as unclear and mechanism research
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Example 1 Lactobacillus brevis L. brevis Combination with microcrystalline cellulose
[0028] L. brevis Adhesion to cellulose and xylan
[0029] Determined by co-precipitation method according to the method described in the literature L. brevis Adhesion to insoluble PCWP (plant cell wall polysaccharide). L. brevis Cultured in MRS medium for 2 days. After high-speed centrifugation, the cells were transferred to fresh MRS medium containing different carbon sources (glucose, wheat arabinoxylan WAX and WAX+xylanase). Continue to cultivate for 6 h. Then with PC buffer (10 mM citrate-Na 2 HPO 4 , pH 5.0, 75 mM NaCl) washed cells twice, resuspended OD in the same buffer 600 to 0.7. Equal amounts (0.5 mL each) of the bacterial solution and Avicel suspension (0.5 mL PC buffer) were mixed. The mixture was mixed by inversion slowly for 30 min at room temperature. Next, the bacteria-cellulose / xylan suspension was left to stand at room temperature for 30 min, and 20...
Embodiment 2
[0031] Example 2 Cloning of Lb630 protein-coding gene and binding of protein Lb630 containing WxL domain to cellulose and xylan
[0032] Cloning, expression and purification of recombinant proteins
[0033] Specific primers:
[0034] PLb630F (5'-tggtgccgcgcggcagcGACTCAACCCAAAAGACCAC-3') and PLb630R (5'-ggtggtggtggtgctcgagtTTATTCCGGCGTATTACCCAACGTCCACG-3').
[0035] Use the above specific primers to amplify by PCR using the Lactobacillus brevis genomic DNA template Lb630 Gene. Insert the amplified product into pET-28a(+)( Nde I / not 1) vector, obtain pET28a-Lb630 recombinant transformant. The recombinant plasmid was transformed into Escherichia coli BL21 (DE3) competent cells. Positive transformants were picked and cultured overnight at 37 °C in LB. The next day, they were transferred to 300 mL of fresh LB medium, and cultured for 3 h. When OD 600 When it reached 0.6-0.8, IPTG with a final concentration of 0.5 mM was added to induce the expression of the recombinant...
Embodiment 3
[0048] Example 3 Mutation study of Lb630
[0049] Construction and expression of Lb630 mutant
[0050] Use Novizym's point mutation kit to design point mutation primers according to the instructions, and perform site-directed mutation on Lb630. Carry out PCR amplification with the diluted pET28a-Lb630 plasmid as a template, add Dpn I restriction endonuclease digests the template plasmid. Then the PCR product was transformed into Escherichia coli Trans1-T1 competent cells, and the transformants were sequenced and verified. The primer sequences for point mutations are as follows:
[0051] F30A-F: TCCGCCCCAGATGTTAGTGCGTCCGCGCAGT,
[0052] F30A-R: CGCACTAACATCTGGGGCGGAGTCTAACTTGATCCCACC;
[0053] W61A-F: GCCGGCTCGGCAACTGGTGCGAACGTAAAGG,
[0054] W61A-R: CGCACCAGTTGCCGAGCCGGCATTGGTTAC;
[0055] F85A-F: TATGGGGCAACAACTACAGCGGCTAAACCCTC,
[0056] F85A-R: AGTTGTTGCCCCATATGTTGCACCAGCTAACG;
[0057] F108A-F: CGACTGCTAACAATCTCAGCGCGAACGGTGCTGGTAGT,
[0058] F108A-R: CGCGCTGA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More