Application of DNA tetrahedral framework nano nucleic acid in cosmetology
A technology of tetrahedron and DNA molecules, which is applied in the field of beauty and skin care, can solve the problem of not being able to know the inhibitory effect of DNA tetrahedron frame nucleic acid on skin fibrosis, and achieve good application prospects, enhanced effects, and strong stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1. Synthesis and identification of DNA tetrahedral framework nanonucleic acid
[0033] 1. Synthesis of DNA tetrahedral framework nanonucleic acid
[0034] The four DNA single strands (S1, S2, S3, S4) were dissolved in TM Buffer (10 mM Tris-HCl, 50 mM MgCl) in an equimolar ratio. 2 , pH=8.0), the final concentrations of the four DNA single-strands were 1000 nM, respectively, mixed well, rapidly heated to 95 °C for 10 minutes, and then rapidly cooled to 4 °C and maintained for more than 20 minutes. DNA tetrahedral framework nanonucleic acids (tFNAs) can be obtained by the self-assembly process of the strands in the system according to the principle of complementary base pairing. The synthesis process of tFNAs is as follows figure 1 a shown. The sequences of the four single strands (5′→3′) are as follows:
[0035] S1:
[0036] ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA (SEQID NO. 1)
[0037] S2:
[0038] ACATGCGAGGGTCCAATACCGACGATTACAGCT...
Embodiment 2
[0052] Example 2. Research on the treatment of skin scleroderma with DNA tetrahedral framework nanonucleic acid
[0053] Sixty 6-8 week old male Balb / c mice weighing 18-22g were randomly divided into four groups (blank control group (Ctrl), model group (B), 125nM dose treatment group (B+125nM T) and 250nM dose-treated group (B+250 nM T)) and maintained in an environment with a 12h / 12h light / dark cycle. After the initial 7 days of acclimation, a 1 cm x 1 cm square was marked in the center of a 2 cm x 2 cm shaved area on the upper back skin using a permanent marker. Bleomycin hydrochloride was dissolved in PBS (the concentration was 0.5 mg / mL), and each mouse in the treatment group and the model group was injected with bleomycin solution (100 μl / time), which was injected on the back of the mice every other day. , for a total of 21 days, to create a scleroderma model, and the mice in the blank control group were injected with the same amount of PBS solution; after the completion...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

