Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of DNA tetrahedral framework nano nucleic acid in cosmetology

A technology of tetrahedron and DNA molecules, which is applied in the field of beauty and skin care, can solve the problem of not being able to know the inhibitory effect of DNA tetrahedron frame nucleic acid on skin fibrosis, and achieve good application prospects, enhanced effects, and strong stability

Pending Publication Date: 2022-06-03
SICHUAN UNIV
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the pathogenesis of pulmonary fibrosis is mostly related to infection, while the pathogenesis of skin fibrosis includes mechanical stimulation, autoimmune diseases (such as systemic sclerosis, scleroderma), etc., so it is impossible to know the effect of DNA tetrahedral framework nucleic acid on skin fibrosis. Inhibitory
At present, there are no reports on the application of DNA tetrahedral framework nucleic acid in skin fibrosis, especially scleroderma, and in cosmetic treatments such as anti-wrinkle, firming and rejuvenating, and whitening.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of DNA tetrahedral framework nano nucleic acid in cosmetology
  • Application of DNA tetrahedral framework nano nucleic acid in cosmetology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1. Synthesis and identification of DNA tetrahedral framework nanonucleic acid

[0033] 1. Synthesis of DNA tetrahedral framework nanonucleic acid

[0034] The four DNA single strands (S1, S2, S3, S4) were dissolved in TM Buffer (10 mM Tris-HCl, 50 mM MgCl) in an equimolar ratio. 2 , pH=8.0), the final concentrations of the four DNA single-strands were 1000 nM, respectively, mixed well, rapidly heated to 95 °C for 10 minutes, and then rapidly cooled to 4 °C and maintained for more than 20 minutes. DNA tetrahedral framework nanonucleic acids (tFNAs) can be obtained by the self-assembly process of the strands in the system according to the principle of complementary base pairing. The synthesis process of tFNAs is as follows figure 1 a shown. The sequences of the four single strands (5′→3′) are as follows:

[0035] S1:

[0036] ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA (SEQID NO. 1)

[0037] S2:

[0038] ACATGCGAGGGTCCAATACCGACGATTACAGCT...

Embodiment 2

[0052] Example 2. Research on the treatment of skin scleroderma with DNA tetrahedral framework nanonucleic acid

[0053] Sixty 6-8 week old male Balb / c mice weighing 18-22g were randomly divided into four groups (blank control group (Ctrl), model group (B), 125nM dose treatment group (B+125nM T) and 250nM dose-treated group (B+250 nM T)) and maintained in an environment with a 12h / 12h light / dark cycle. After the initial 7 days of acclimation, a 1 cm x 1 cm square was marked in the center of a 2 cm x 2 cm shaved area on the upper back skin using a permanent marker. Bleomycin hydrochloride was dissolved in PBS (the concentration was 0.5 mg / mL), and each mouse in the treatment group and the model group was injected with bleomycin solution (100 μl / time), which was injected on the back of the mice every other day. , for a total of 21 days, to create a scleroderma model, and the mice in the blank control group were injected with the same amount of PBS solution; after the completion...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides application of DNA tetrahedral framework nano nucleic acid in beauty, and relates to the technical field of beauty and skin care. Researches find that tFNAs can effectively inhibit skin fibrosis and improve skin scleroderma symptoms, and tFNAs are expected to be applied to preparation of drugs for preventing and / or treating skin scleroderma. Furthermore, due to the fact that the tFNAs can improve skin symptoms, the tFNAs can be applied to beauty treatment and have the effects of resisting wrinkles, tightening and tendering the skin, whitening the skin and the like. In addition, tFNAs is also a drug carrier and can entrap other drugs for treating skin diseases or beautifying, so that the effect is enhanced. Therefore, the tFNAs has a good application prospect.

Description

technical field [0001] The invention relates to the technical field of beauty and skin care, in particular to the use of DNA tetrahedral framework nano-nucleic acid in beauty. Background technique [0002] The skin is the largest organ of the human body and plays a vital role as the first line of defense against various endogenous and exogenous infectious agents and injuries. At the same time, skin condition and appearance are also closely related, so skin condition has received widespread attention. Adverse events affect skin homeostasis, making the skin susceptible to a variety of irritants and toxins. When the intensity or duration of skin damage exceeds the capacity of tissue repair, skin fibrosis, caused by a dysregulated tissue repair response, begins to dominate the repair process. The heterogeneity of the skin tissue repair response may lead to scarring, which is the result of pathological connective skin tissue repair, and can be observed in hypertrophic scars and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K31/711A61P17/00A61K8/60A61Q19/00A61Q19/08A61Q19/02
CPCA61K31/711A61P17/00A61K8/606A61Q19/00A61Q19/08A61Q19/02
Inventor 林云锋姜玥莹蔡潇潇
Owner SICHUAN UNIV