Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for increasing carotenoid content of corn kernels by using gene editing technology

A gene editing and carotene technology, applied in the field of genetic engineering, can solve the problems of gene redundancy, time-consuming, limiting the application effect of improved materials, etc., and achieve the effect of increasing the content

Active Publication Date: 2022-07-05
JILIN ACAD OF AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The creation of traditional high-carotene corn materials is mainly through the method of backcrossing, which often requires 6 backcrossing generations, which is not only time-consuming, but also often accompanied by gene redundancy, which leads to the introduction of some non-target traits and limits the improvement of materials application effect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for increasing carotenoid content of corn kernels by using gene editing technology
  • Method for increasing carotenoid content of corn kernels by using gene editing technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1 Construction of gene editing vector

[0043] (1) starch debranching enzyme gene ZmISA2, its nucleotide sequence is as follows:

[0044] ATGGCCTCCTCCCTCCCCGCGCCGCCGGCCTCGCCCTCTTCCTCCTGGCGCGGACTCACGCCCCGCTGCCCTCCGCCTCGCTGCGGTCCCCTCCTCGCCCGCGCGGTAGCGCGTTCTTACCGTTACCGCTTCCGAACCGACGACGACGGCGTGGTGGACGTGGCCGTCGCCGGGAAAGACGGCGATGCGGGGTATGTGGTCGCTATCGAGGCTCCTACCCATGGACAGAGGGGCGGTCTTGTGCTCCGCCCCGCCGGCTCCGGCGAGGGCGTCCCTCTGGCCCCAGCCGCGCCGGGAGGTGCCCTCGTGGCTGAGTTGTCCTACGACGTGGCCCGCGCGCCGTTCCACGTCTCGTTCACGCTGGCCGACGCGATGGGAGCGGAGATACGGACACACCGCGGGACGAGCTTCCGCGTGCCTGTTGGCGTCGGACGGGGCTGCCCCTCGCCGCTCGGCCTGTCCCAGTCCAAGGATGGGGCCGCTAACTTCGCGGTTTACAGCAAGATCGCCAAGGGCATGGTGCTCTGCCTCTTCGGTGGTGGCGGCGGGGACGGACCCGCGCTGGAGATTGAGCTCGACCCGTACGTCCACCGGACCGGCGATGTCTGGCACGTCTCGATGGAGAGCGTGGAGGGGTACGCCCGCTACGGCTTCCGCAGCGGGCTGTTCGCAATGTTTGGCATTGACCGCCCGCTACTCGACCCGTACGCCAAGGTGATCGGGGACTTCGTCGCTGGCGACTCTGTTGATGAGGATGGGCTAGCTGTGCCATCCATAAGGTGTCTCGCGTCCTTGAAGAATGCACCCAACTACGATTGGGGCAGGGACAAGCACCCATGC...

Embodiment 2

[0081] Example 2 The gene editing vector was transformed into Agrobacterium LBA4404

[0082] 1) CaCl 2 Preparation of Agrobacterium tumefaciens competent cells

[0083] (1) From the YEP plate (Rif R ,Str R ), pick a fresh LBA4404 single colony and inoculate it in YEP liquid medium containing 50mg / L Str and 25mg / L Rif, 28°C, 220rpm shaking culture overnight for 24-36h;

[0084] (2) Take 2ml of the bacterial liquid in the logarithmic growth phase activated overnight, inoculate it in 50mL YEP liquid medium, and cultivate the bacterial liquid OD at 20°C 600 to about 0.4 to 0.6;

[0085] (3) Transfer the bacterial liquid to an ice-precooled 50 mL sterile centrifuge tube, ice bath for 30 min, centrifuge at 4,000×g for 10 min at 4°C, and enrich the bacterial cells;

[0086] (4) Pre-cool 0.05M CaCl with 10mL ice 2 Suspend the bacterial cells, take an ice bath for 30 min, centrifuge at 4,000 × g for 10 min at 4 °C, and enrich the bacterial cells;

[0087] (5) Pre-chill 0.05M CaC...

Embodiment 3

[0101] Example 3 Maize genetic transformation

[0102] (1) The material for embryo extraction was the corn inbred line C01. The young maize embryos were observed on the ninth day after pollination. When the embryos grew to about 1.5 mm, the ear was taken back to the laboratory for embryo extraction.

[0103] (2) Prepare the Agrobacterium infection solution, and shake the activated Agrobacterium (Agrobacterium tumefaciens containing pBUE411-1gR-ZmIsa2, or Agrobacterium tumefaciens containing pBUE411-2gR-ZmIsa3-ZmZpu1) in YEB liquid medium bacteria to a specific concentration (OD 550 = 0.5), collect the cell pellet by low-speed centrifugation, and then use inf (per liter composition: N6 salt and vitamin (sigma) 2 g, sucrose 68.5 g, glucose 36 g, L-proline 0.7 g, MES 0.5 g, 1 mg / ml 2,4-D 1.5ml)+AS (Acetosyringone, (100mM), 1ml)) liquid medium to resuspend, shake at 75r / min at 25°C for 24h, until the concentration is OD 550 =0.3-0.4.

[0104] (3) Wash the immature embryos taken...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for increasing the carotenoid content of corn kernels by using a gene editing technology, and belongs to the technical field of gene engineering. According to the method for improving the carotenoid content of the corn kernels by using the gene editing technology, disclosed by the invention, corn ZmIsa2, ZmIsa3 and ZmZpu1 genes are subjected to gene editing at the same time through a CRISPR / Cas9 technology, mutant materials containing target gene mutation fragments are obtained through further screening, and the materials with the carotenoid content improved in the corn kernels have important breeding value.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a method for improving the carotenoid content of corn kernels by using gene editing technology. Background technique [0002] Carotenoids are a class of important natural pigments with unique structures and functions. They are widely distributed in phototrophic and non-phototrophic species. More than 700 natural carotenoids have been identified, and their chemical diversity is very rich. Carotenoids are chemically or enzymatically converted into other derivatives such as vitamin A, plant hormones or aromatic compounds; vitamin A deficiency is one of the major micronutrient deficiencies worldwide. Studies have shown that a diet rich in carotenoids (consisting mainly of fruits and vegetables) can promote health while helping to reduce the risk of certain cancers and cardiovascular, eye, skin or bone diseases. Since carotenoids cannot be synthesized by the human body, b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/84C12N15/56A01H5/10A01H6/46
CPCC12N15/825C12N15/8218C12N15/8205C12N9/246C12Y302/01068
Inventor 宋广树吕庆雪周迎鑫孙蕾周德龙
Owner JILIN ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com