Bacterial strain for degrading thiocyanate, composite bacterial strain, microbial inoculum and application of bacterial strain, composite bacterial strain and microbial inoculum

A technology of thiocyanate and thiocyanic acid, which is applied in the direction of microorganism-based methods, bacteria, biological water/sewage treatment, etc., can solve the problems of inability to meet market demand, low degradation ability of single bacteria, high treatment cost, etc., and achieve The effect of shortening the degradation cycle, stable operation and high degradation efficiency

Pending Publication Date: 2022-07-29
NANCHANG GUOCHANG ENVIRONMENTAL PROTECTION TECH +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the methods commonly used to treat thiocyanate-containing wastewater at home and abroad include oxidation recovery method, alkali chlorine method, inco method, biological method, etc. The existing methods have high treatment cost, low efficiency, easy to cause secondary pollution, and single bacteria Low degradation ability, unable to meet market demand

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacterial strain for degrading thiocyanate, composite bacterial strain, microbial inoculum and application of bacterial strain, composite bacterial strain and microbial inoculum
  • Bacterial strain for degrading thiocyanate, composite bacterial strain, microbial inoculum and application of bacterial strain, composite bacterial strain and microbial inoculum
  • Bacterial strain for degrading thiocyanate, composite bacterial strain, microbial inoculum and application of bacterial strain, composite bacterial strain and microbial inoculum

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] This embodiment is the screening process of Lysinibacillus sp.S3, Acinetobacter seifertii LB3, Thiobacillus sp.A, Pseudomonas sp.WU6 and Acinetobacter baylyi WU9, specifically including:

[0039] The industrial wastewater containing thiocyanate (from Jiangxi Fengcheng Xingao Coking Co., Ltd.) was screened with a medium containing thiocyanate as the only carbon source, and 5 strains were obtained by screening, which were recorded as S3, LB3, A. WU6 and WU9;

[0040] The 5 strains obtained above were classified and identified by 16srDNA gene sequencing method, wherein the gene sequence of A is shown in SEQ ID NO: 1, and the details are as follows:

[0041]ATTGAACGCTGGCGGAATGCTCCACACATGCAAGTCGAACGGCAGCACGGGAGCTTGCTCCTGGTGGCGAGTGGCGAACGGGTGAGTAATGCGTCGGAACGTGCCGAGTAATGGGGGATAACGCGGCGAAAGTCGCGCTAATACCGCATACGCCCTGAGGGGGAAAGCGGGGGATCGCAAGACCTCGCGCCATTCGAGCGGAAGACGTCTGATTAGCTAGTTGGTGGGGTAAAGGCCCACCAAGGCGACGATCAGTAGCGGGTCTGAGAGGATGATCCGCCACACTGGGACTGAGACACGGCAAAGACTCCTACGGGAGGCA...

Embodiment 2

[0052] This embodiment is a composite strain for degrading thiocyanate, the composite strain includes Lysinibacillus sp.S3, Acinetobacter seifertii LB3, Thiobacillus sp.A, Pseudomonas sp. .WU6, Acinetobacter baylyi WU9;

[0053] Among them, the deposit number of Lysinibacillus sp.S3 in the China Collection of Type Cultures is CCTCC NO: M2022214, the deposit number of Acinetobacter seifertii LB3 in the China Collection of Type Cultures is CCTCC NO: M2022215, and the deposit number of Thiobacillus sp.A in the China Type Culture Collection The deposit number of the center is CCTCCNO: M2022216, the deposit number of Pseudomonas sp.WU6 at the China Center for Type Culture Collection is CCTCC NO: M2022217, and the deposit number of Acinetobacter baylyi WU9 at the China Center for Type Culture Collection is CCTCC NO: M2022218;

[0054] The mass ratio of Lysinibacillus sp.S3, Acinetobacter seifertii LB3, Thiobacillus sp.A, Pseudomonas sp.WU6 and Acinetobacter baylyi WU9 in the composi...

Embodiment 3

[0056] The present embodiment is a degradation method of thiocyanate in thiocyanate-containing waste water, and the degradation method comprises the following steps:

[0057] (a) preparation of embodiment 1 compound strain:

[0058] Each strain was inoculated into the LB medium for activation, and then expanded and cultured. Then, the culture medium of the expanded culture was centrifuged at 8000 r / min at 4°C, and the culture medium was removed, rinsed with physiological saline, and centrifuged to obtain each bacterial cell;

[0059] Each bacterial body is dried at room temperature, and each bacterial species is mixed according to the mass ratio to obtain a composite strain;

[0060] (b) According to the inoculation amount of 6g / L, inoculate the composite strain into the wastewater containing thiocyanate to degrade thiocyanate for 36h, wherein, the temperature of the wastewater is controlled to be 28~35°C, and the dissolved oxygen content is 2~35°C. 5mg / L, pH value is 6.7~7....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a bacterial strain for degrading thiocyanate, a compound bacterial strain, a bacterial agent and application of the bacterial strain, the compound bacterial strain and the bacterial agent. The compound bacterial strain comprises lysinibacillus sp. S3, Acinetobacter sifertii LB3, Thiobacillus sp. A, Pseudomonas sp. WU6 and Acinetobacter bayi WU9, and the compound bacterial strain is prepared from bacillus amyloliquefaciens sp.S3, Acinetobacter sifertii LB3, Thiobacillus sp. A, Pseudomonas sp. WU6 and Acinetobacter bayi WU9. Specific strains are compounded together, so that the synergistic interaction of the strains is realized, the thiocyanate in the wastewater is efficiently degraded, the treatment efficiency of the thiocyanate-containing wastewater is remarkably improved, and the degradation period of the thiocyanate-containing wastewater is effectively shortened. Specifically, the compound strain can effectively degrade the industrial wastewater with the thiocyanate concentration of 3000mg / L within 36 hours, and the degradation method is high in degradation efficiency, short in period, stable in operation and capable of better meeting market requirements.

Description

technical field [0001] The invention relates to the technical field of thiocyanate degradation, in particular to a bacterial strain, a composite bacterial strain, a bacterial agent and an application for degrading thiocyanate. Background technique [0002] Thiocyanate is not a highly toxic substance. As one of the contributors to COD, it has little impact on the environment. However, thiocyanate will be decomposed into CNO under the synergistic action of oxygen and microorganisms. - , and then produce highly toxic cyanide, so thiocyanate may produce secondary pollution. Thiocyanate is generally produced through the cyanide tailings of gold concentrate biological oxidation plants, the production wastewater of electrolytic copper and electroplating industries. [0003] At present, the commonly used methods for treating thiocyanate-containing wastewater at home and abroad include oxidative recovery method, alkali chloride method, inoculation method, biological method, etc. The...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20C02F3/34C12R1/01C12R1/38C02F101/16
CPCC12N1/20C02F3/34C02F2101/16C02F2101/101
Inventor麦荣张庆华肖小双罗轶维
OwnerNANCHANG GUOCHANG ENVIRONMENTAL PROTECTION TECH