Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

RPA-LbCas12a system-based composition for visual detection of nasal-like carbuncle and application of RPA-LbCas12a system-based composition

A composition, genome technology, applied in the direction of DNA/RNA fragments, recombinant DNA technology, biochemical equipment and methods, etc., can solve the problems of wrong treatment, aerosol pollution, background interference of people, etc.

Pending Publication Date: 2022-07-29
ARMY MEDICAL UNIV
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although isolation and culture is the gold standard for infection diagnosis, it takes a long time, and it is easy to miss the best opportunity for diagnosis and treatment. In addition, if there is no relevant experience, it is easy to be misidentified as pollution or other bacteria of the same species, which will lead to wrong treatment and delay the patient's condition; Due to the interference of the window period and the background of the population in the epidemic area (the positive rate of serum antibodies in the local population in Hainan is 6% to 20%), it is very easy to cause false negative or false positive results in serological detection; Bacterial mass spectrometry identification based on proteomics analysis has no effect on bacteria. The concentration and purity of the sample are required, and the detection results of some strains are unstable due to regional differences and database update lags; currently reported molecular biology methods are mainly based on PCR methods and Lamp (loop-mediated Isothermal amplification), detection of target genes including 16s rRNA and type III and type VI secretion system gene clusters, etc., 16s rRNA of Burkholderia pseudomallei and Burkholderia thailand and Burkholderia The sequence difference is small, which can easily lead to identification errors; the PCR method has high requirements on instrument conditions and personnel operations, and is not suitable for bedside rapid diagnosis (quick detection in the field); and the Lamp method is easy to form aerosol pollution, resulting in false positives result

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RPA-LbCas12a system-based composition for visual detection of nasal-like carbuncle and application of RPA-LbCas12a system-based composition
  • RPA-LbCas12a system-based composition for visual detection of nasal-like carbuncle and application of RPA-LbCas12a system-based composition
  • RPA-LbCas12a system-based composition for visual detection of nasal-like carbuncle and application of RPA-LbCas12a system-based composition

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1. Establishment of Burkholderia melioidosis RPA-LbCas12a detection system

[0043] 1. Selection of target sequences

[0044] Through analysis, we selected the nucleotide sequence of 2381740-2382182 bp on chromosome 1 of Burkholderia melioidans BPC006 strain (GenBank: CP003781.1) as the target sequence for Burkholderia melioidans gene detection, such as SEQ ID NO: 10.

[0045] Target sequence for Burkholderia melioidosis gene detection (443bp):

[0046] GGGACGCATACACTACCAGATTTGATAGTTTCGTCCTTTCAAAATCTAGACTCTAATAAACTCGCACACTTTTCCCATCACATCGATGGCGATTAACCAATAAATCCAGTGGAGTTAAAAATGGGCAAAGCGAATACCATCGAGCTCACAAACAACACATCATTTACTCTCGTCCTGCATACGATATACGCCAACACGGGCAATTGGTCCGGCGATTATCCGCCGGCCTATTTACGGCCGAACGATACGCTTATTTTTACGAGTACGCTTGATGGAAAAGGAGATCTAAACGGCTCAGCCCGTTTCGACATCCTTGATACAGCGGTCAAGAGATGTCCGGACGCGACCTACGTACAGCTCAACTGGGACAATCCCGTCGGAGCGGACAATGGGGGATCCTCGTCCGTAGTCGGCGCCACAGCACAGTTCTTCAACGTAAGTGG(SEQID NO:10)。

[0047] 2. Design of RPA primers and crRNA

[0048] For ...

Embodiment 2

[0101] Example 2. Evaluation of sensitivity and specificity of Burkholderia melioidosis RPA-LbCas12a detection system

[0102] Normal blood genomic DNA was extracted from human normal blood samples using Quick DNA / RNA Pathogen miniprep Kit (ZYMO RESEARCH, R1042) for the following sensitivity and specificity evaluation experiments. Human normal blood samples were provided by the Laboratory of Clinical Microbiology and Immunology, Department of Pharmacy and Laboratory Medicine, Army Medical University.

[0103] 1. Sensitivity evaluation

[0104] The genomic DNA of Burkholderia pseudomallei BPC006 strain quantified by real-time fluorescent quantitative PCR was added to the normal blood genomic DNA solution to obtain 1.35 copies / μL, 2.7 copies / μL, 27 copies / μL, 270 copies / μL, 2700 copies / μL copies / μL, 27,000 copies / μL, and 270,000 copies / μL of Burkholderia melioidans nucleic acid samples. Take 5 μL of Burkholderia melioidi nucleic acid samples of various concentrations as templa...

Embodiment 3

[0109] Example 3. ROC curve verification of Burkholderia melioidosis RPA-LbCas12a detection system

[0110] The normal blood samples used in this experiment were human normal blood samples, which were provided by the Laboratory of Clinical Microbiology and Immunology, Department of Pharmacy and Laboratory Medicine, Army Medical University. The Burkholderia pseudomallei bacteria solution used in this experiment was the Burkholderia pseudomallei BPC006 strain.

[0111] First prepare the following samples:

[0112] Sample 1: Take 20 normal blood samples and extract genomic DNA respectively;

[0113] Sample 2: Take 20 normal blood samples, add a certain amount of Burkholderia pseudomallei bacteria solution respectively, and then extract genomic DNA respectively; the number of copies of the genome DNA of Melioidosis in the extracted genomic DNA is about 1-2.7 copies / μL;

[0114] Sample 3: Take 20 normal blood samples, add a certain amount of Burkholderia pseudomallei bacteria s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of molecular diagnosis, in particular to a composition for visually detecting nasosphallex-like carbuncle based on an RPA-LbCas12a system and application of the composition. The invention provides a composition for detecting Burkholderia pseudomallei. The composition comprises an RPA (recombinase polymerase amplification) primer, crRNA (complementary Ribonucleic Acid), LbCas12a protease and an ssDNA (single-stranded deoxyribonucleic acid) fluorescent probe, the nucleotide sequences of the RPA primer are as shown in SEQ ID NO: 5 and SEQ ID NO: 6; the nucleotide sequences of the transcription template of the crRNA are shown as SEQ ID NO: 7 and SEQ ID NO: 9. Based on the composition, the invention also provides a method for detecting the burkholderia pseudomallei. According to the method, through combination of RPA amplification and a CRISPR-Cas12a system, the sensitivity with the lower detection limit of 2.7 copies / mu L and higher specificity are obtained, whether a sample contains the burkholderia pseudomallei or not can be detected within 1 h, large instruments and equipment are not needed, and rapid diagnosis and screening of the burkholderia pseudomallei are facilitated.

Description

technical field [0001] The invention relates to the technical field of molecular diagnosis, in particular to a composition for visual detection of Burkholderia pseudomallei based on an RPA-LbCas12a system and an application thereof. Background technique [0002] Melioidosis (Melioidosis) is a disease caused by Burkholderia pseudomallei (Bp) infection through respiratory aerosols or skin ulceration, and its natural foci are subtropical areas such as Hainan and the southeast coast of my country. . With the increase in population mobility in recent years, imported cases have also occurred in unnatural foci. At present, there is no effective treatment plan for BP infection, and there is no vaccine protection; Bp is easy to obtain, easy to spread, and widely resistant to resistance, and has been included in the international "Biological Weapons Convention" verification list and the US CDC Class I bioterrorism agent; the clinical manifestations of infection are "occult" Or "like ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/689C12Q1/6883C12N15/11C12Q1/6844C12Q1/6851
CPCC12Q1/689C12Q1/6883C12Q1/6844C12Q1/6851C12Q2600/158C12Q2521/507C12Q2521/119C12Q2522/101C12Q2521/327C12Q2563/107C12Q2527/101C12Q2561/113C12Q2531/113
Inventor 向阳邓铃何晓奕夏涵毛旭虎
Owner ARMY MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products