Unlock instant, AI-driven research and patent intelligence for your innovation.

Nucleic acid reagent and digital PCR kit for detecting providencia

A Providence bacterium and kit technology are applied in the field of nucleic acid reagents and digital PCR kits for the detection of Providence bacterium, and can solve the problem that Providence bacterium has not yet been developed.

Inactive Publication Date: 2022-07-29
PEKING UNION MEDICAL COLLEGE HOSPITAL CHINESE ACAD OF MEDICAL SCI +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, no detection kits capable of simultaneously detecting multiple Providencia bacteria have been developed yet.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid reagent and digital PCR kit for detecting providencia
  • Nucleic acid reagent and digital PCR kit for detecting providencia
  • Nucleic acid reagent and digital PCR kit for detecting providencia

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1 Detection method and detection result determination

[0042] 1. Primer and probe synthesis

[0043] Sequence synthesis was performed according to the primer sequences shown in Table 1 and the probe sequences shown in Table 2. In the probe, FAM, VIC, CY5 and A425 are fluorescent groups; MGB and BHQ1 are quenching groups.

[0044] Table 1

[0045]

[0046] Table 2

[0047] serial number probe code sequence retouch Detection target 9 LSP CACATGCAGATTTC FAM-MGB Providencia reye 10 SSP CAAACCACATGCTGAC VIC-MGB Providencia stutzeri 11 CJP AACCTCATGCGGATTT CY5-MGB Providencia alcaligenes 12 IC-P CGCGACGGATCTACGTCACAGCG A425-BHQ1 External internal control

[0048] The nucleotide sequences of SEQ ID NO. 13-15 are shown below:

[0049] >P.rettgeri (Providence reckii)

[0050] ATGAAAGCACTGACGGCTCGACAACAGCAGGTTTACGATCTAGTGCGTGACCACATTTCGCAGACGGGTATGCCTCCTACACGCGCTGAGATAGCAGCAAGCCTTGGTTTTCGTTCGCCT...

Embodiment 2

[0074] Example 2 Specificity and Sensitivity Assays

[0075] Providencia reye, Providencia stutzeri, Providencia alcaligenes, Pseudomonas aeruginosa, Escherichia coli, Klebsiella pneumoniae, Acinetobacter baumannii, Staphylococcus aureus, feces Enterococcus, Enterococcus faecalis and Streptococcus pneumoniae were obtained from purchased inactivated bacteria.

[0076] The Providencia-specific primer pairs and probes designed in Example 1 were evaluated and validated. The reaction system was the same as in Example 1, and digital PCR amplification was performed. FAM, VIC, CY5 and A425 were selected as reporter groups, and the reaction procedure was the same as that of Example 1.

[0077] Judgment of PCR amplification results: blank control and negative control established;

[0078] The results are shown in Table 4. The DNA of Providencia reinhardtii was detected, and there were detected values ​​in the FAM channel and the internal control A425 channel, indicating the nucleotid...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a nucleic acid reagent and a digital PCR (polymerase chain reaction) kit for detecting providencia. The nucleic acid reagent comprises primers as shown in SEQ ID NO. 1-6 and probes as shown in SEQ ID NO. 9-11. According to the invention, a detection system for simultaneously detecting the providencia stuartii, the providencia alcaligenes and the providencia reevesii is established; a detection system contains an exogenous internal control as a contrast, and quality control can be carried out on the detection process; the detection result has good sensitivity and specificity.

Description

technical field [0001] The present disclosure relates to the field of biotechnology, in particular, to nucleic acid reagents and digital PCR kits for the detection of Providencia. Background technique [0002] Providence, consistent with the general definition of Enterobacteriaceae, is a facultative anaerobic, gram-negative straight bacterium that is motile with pericytes and does not appear in clusters. Oxidized Deaminated Phenylalanine and Tryptophan. Isolated from diarrhea stool, urinary tract infection, wound, burn and bacteremia specimens. Providencia is an opportunistic pathogen that can cause diseases such as diarrhea, extra-intestinal infections, and urinary tract infections. Common Providencia species include Providencia alcaligenes, Providencia rayii, and Providencia stutzeri. However, a test kit capable of simultaneously detecting multiple Providence species has not yet been developed. SUMMARY OF THE INVENTION [0003] The purpose of the present disclosure i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/689C12Q1/6851C12Q1/04C12N15/11
CPCC12Q1/689C12Q1/6851C12Q2600/16C12Q2600/166C12Q2531/113C12Q2563/159C12Q2563/107C12Q2545/113C12Q2537/143C12Q2545/101
Inventor 杨启文喻玮贾沛瑶朱盈夏江朱海涛李锋超
Owner PEKING UNION MEDICAL COLLEGE HOSPITAL CHINESE ACAD OF MEDICAL SCI