Sclerotinite anti carbendazol detection gene and its detecting method
A technology of Sclerotinia sclerotiorum and carbendazim is applied in the field of Sclerotinia sclerotiorum anti-carbendazim detection gene and its detection field. Easy to learn, simple method, time-saving effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1 PCR amplification to obtain the β-tubulin gene associated with Sclerotinia sclerotiorum anti-multiple bacteria
[0029]According to the high homology of β-tubulin in other pathogenic fungi, 3 pairs of primers were designed.
[0030] BAF6 (5'ACCCACAACCGCCAACATGCGTGA3')
[0031] CP-1 (5'GGTGATCTGGAAACCCTGGAGGCA3')
[0032] B1(5'A(AG)AT(CT)ACCCA(CT)TC(CT)CT(CT)GGTGGTGG 3')
[0033] B3(5'CTCCAT(CT)TC(AG)TCCAT(ACT)CC(CT)TC(AG)CC 3')
[0034] BAF3 (5'GCTCGAGCGCATGAACGTCTACTT3')
[0035] END3(5'AT(TC)TA(CT)TCCTCGCCCTCAA3')
[0036] 50μL reaction system containing 100ng genomic DNA as template, 5μL 10×buffer (10mM Tris-HCl, 50mM KCl, 0.1% TritonX100), MgCl 2 2mM, TaqDNA polymerase 1U (Shanghai Promga), dNTP 0.2mM, primers 0.5μM each. Reaction conditions for primers B1 / B3: 94°C for 5 min, 1 cycle; 65°C for 2 min, 72°C for 2 min, 94°C for 1 min, 30 cycles; finally, 72°C for 5 min. BAF6 / CP-1 and BAF3 / END3 reaction conditions: 94°C for 5min; 60°C for 50s, 94°C for...
Embodiment 2
[0039] Example 2 Rapid detection of carbendazim resistance of Sclerotinia sclerotiorum on rape in Tongzhou City, Jiangsu Province in 2002
[0040] With the sclerotia collected back in 2002, 100 were randomly selected, and a small piece (30-50 mg) of the sclerotia was cut off respectively, and 3.5% (mg / L) NaClO 3 Disinfect for 5 minutes; add 1.5mL extraction buffer (100mmol / LLiCl; 10mmol / L EDTA; 10mmol / L Tris-HCl, pH8.0; 10g / L SDS) to the sterilized Sclerotinia sclerotiorum sclerotia block and add 0.2g of Quartz sand, fully ground; warm bath at 60°C for 10 minutes; centrifuge at 10,000 rpm for 4 minutes; suck out 700 μL of supernatant, and extract with 700 μL of extract (phenol, chloroform, isoamyl alcohol prepared in a volume ratio of 25:24:1) 2 times; suck out 600 μL of supernatant again, add 600 μL of isopropanol; place at -20°C for 1 hour; centrifuge at 10,000 rpm for 20 minutes; discard the supernatant, dry the precipitate, dissolve in 200 μL of TE buffer (10 mmol / L Tris-H...
Embodiment 3
[0046] Example 3 Rapid detection of carbendazim resistance of Sclerotinia sclerotiorum on rapeseed in Jurong City, Jiangsu Province in 2003
[0047] With the sclerotia collected back in 2003, 80 were randomly selected, and a small piece (30-50 mg) of the sclerotia was cut off respectively, and 3.5% (mg / L) NaClO 3 Disinfect for 5 minutes; add 1.5mL extraction buffer (100mmol / LLiCl; 10mmol / L EDTA; 10mmol / L Tris-HCl, pH8.0; 10g / L SDS, the rest is water, sterilized by autoclaving) and 0.2g of quartz sand that has been sterilized by autoclaving, fully ground; warm bath at 60°C for 10min; centrifuge at 10000rpm for 4min; suck out 700μL of supernatant, and use 700μL of extracting solution (phenol, chloroform, isoamyl alcohol according to The volume ratio was adjusted to 25:24:1) and extracted twice; 600 μL of supernatant was sucked out again, and 600 μL of isopropanol was added; placed at -20°C for 1 hour; centrifuged at 10,000 rpm for 20 minutes; TE buffer solution (10mmol / L Tris-H...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
