Biomolecule with therapeutic tumour action and its use

A technology of biomolecules and anti-tumor drugs, applied in the field of biomolecules, can solve the problems of poor stability and weak effect, and achieve the effects of good stability, high selectivity and easy preparation

Inactive Publication Date: 2006-01-18
TIANJIN SAIER BIOTECH
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] The present inventors have carried out in-depth research in order to achieve the above object, and found that a double-stranded RNA molecule (structure shown in Figure 1) with a length of 23 base pairs in a specific order has a clear tumor-inhibiting effect, And the selectivity of its action is high, can overcome the toxic and side effects that quinolines exist to a large extent; Due to the disadvantages of poor stability and weak effect due to easy degradation, its tumor inhibitory effect is significantly higher than that of antisense nucleic acid

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Biomolecule with therapeutic tumour action and its use
  • Biomolecule with therapeutic tumour action and its use
  • Biomolecule with therapeutic tumour action and its use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] The preparation of embodiment 1 tumesurin

[0060] Oncosurin is a double-stranded RNA molecule:

[0061] AGCAAGCCGCAAAGCAUUGGAAU

[0062] AUUCCAAUGCUUUGCGGCUUGCU that is to say, it consists of single-stranded A: AGCAAGCCGCAAAGCAUUGGAAU and single-stranded B: AUUCCAAUGCUUUGCGGCUUGCU, so single-stranded A and single-stranded B must first be synthesized respectively. Now there are commercial companies on the market that can undertake this task. For example, the inventors entrusted Inritrogen Co. USA to synthesize the above-mentioned single-chain A and single-chain B, and provide respective freeze-dried products.

[0063] Then, the RNA molecular lyophilized products of single-strand A and single-strand B synthesized above were respectively dissolved in nuclease-free water, and the respective concentrations were 0.4ug / ul. Each equal amount of simple solution was taken, and 5 times the concentration of Annealing buffer (0.5mM potassium acetate, 150mM Hepes, 100mM ma...

Embodiment 2

[0064] Example 2 Detecting the inhibitory effect of Tumorin on the expression of telomerase gene

[0065] Step (1) with liposome co-transfection method, tumor abolishin and telomerase gene (illustration: because there is no commercially available anti-telomerase antibody with high affinity, it is used to detect tumor cells, such as in liver cancer cell HepG2 cells Telomerase protein expression, so the gene fused with the coding sequence of the telomerase gene and the myc sequence is used to introduce into the cell for expression, and the expression level of myc can be detected indirectly by using a commercially available anti-myc antibody to determine the expression of the telomerase gene) Import Into cultured tumor cells:

[0066]Use 0.7mg pcDNA3 / Hert-myc (on the eukaryotic expression vector pcDNA3, insert the sequence encoding telomerase and myc sequence) and 0.3ug (0.3ul) oncosurin, add 50ul of nuclease-free water to mix, Add 5 ul of lipid (LipofectAmine, GIBCO) and 45 ul ...

Embodiment 3

[0076] Example 3 Detecting the inhibitory effect of oncosurin on the growth of cultured human liver cancer cells (HepG2 cells)

[0077] step 1)

[0078] Tumor and telomerase gene were co-transfected with liposomes (Note: because there is no commercially available high-affinity anti-telomerase antibody for detecting tumor cells, such as telomerase protein in liver cancer cells HepG2 cells Therefore, the gene fused with the coding sequence of the telomerase gene and the myc sequence is introduced into the cell to express it, and the expression level of the myc can be detected with a commercially available anti-myc antibody to indirectly determine the expression of the telomerase gene) into the cultured tumor In the cell:

[0079] Use 0.7mg pcDNA3 / Hert-myc (on the eukaryotic expression vector pcDNA3, insert the sequence encoding telomerase and myc sequence) and 0.3ug (0.3ul) oncosurin, add 50ul of nuclease-free water to mix, Add 5 ul of lipid (LipofectAmine, GIBCO) and 45 ul of...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention is a biomolecule curing tumours, its character: in a special sequence, it is a dichain RNA molecule with 23 basic groups. Its molecular structure contains adenine nucleotide A, guanosine G, cytidine C and uridine U. Its beneficial effects: 1, obvious effect of prohibiting tumour growth and high selectivity, able to overcome poisonous side effect of quinoline drug; 2, good stability; 3, effect amplification; 4, easy to prepare. It can be used to prepare clinical antitumor drug, where the drug form is any one of water solution injection, liposome soliquoid injection and latex.

Description

technical field [0001] The present invention relates to the field of biomedicine, and more specifically, relates to biomolecules capable of treating tumors and their application. Background technique [0002] Tumor has become one of the most serious diseases that endanger human health globally. Due to the complexity of the causes of tumors, effective prevention cannot be carried out; at the same time, due to the particularity of tumor growth, early diagnosis is difficult. Therefore, the treatment of neoplastic diseases mainly depends on clinical treatment. However, most of the current clinical drug treatments do not have obvious selectivity, and there are obvious toxic side effects on normal cells. Therefore, the development of anti-tumor drugs with low toxicity, high selectivity and high effectiveness is the most urgent task in the field of medical biology today. [0003] With the deepening understanding of the molecular mechanism of tumor development, some molecules wit...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C07H21/00A61K31/7088A61K9/08A61K9/107A61K9/12A61P35/00
Inventor 汤华李欣
Owner TIANJIN SAIER BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap