Desmocyte growth factor 11 antibody, antagonist and agonist

A cell and antibody technology, applied in biological testing, anti-fungal/algae/lichen immunoglobulin, material inspection products, etc.

Inactive Publication Date: 2003-04-30
HUMAN GENOME SCI INC
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the other four members segregate as oncogenes whose expression is restricted to embryogenesis and certain types of

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Desmocyte growth factor 11 antibody, antagonist and agonist
  • Desmocyte growth factor 11 antibody, antagonist and agonist
  • Desmocyte growth factor 11 antibody, antagonist and agonist

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0138] Example 1 Bacterial expression and purification of FGF-11 protein

[0139] Amplification of the DNA sequence encoding FGF-11 was initiated using PCR oligonucleotide primers, ATCC #97150, which correspond to the 5' sequence of the processed FGF-11 protein (minus the signal peptide sequence) and the FGF-11 Vector sequences 3' of the 11 genes. Additional nucleotides corresponding to the FGF-11 gene were added to the 5' and 3' sequences, respectively. The 5' oligonucleotide primer 5'CGCGGATCCATCATGAGTGGAAAGGTGACCAAG 3' (SEQ ID NO: 3) contains a BamHI restriction endonuclease site. The 3' sequence 5'CGCGGATCCCGTTGATTCATTGTGGCTCAT 3' (SEQ ID NO: 4) contains the sequence complementary to the BamHI site followed by 21 nucleotides of the FGF-11 coding sequence.

[0140] The restriction enzyme sites correspond to the restriction enzyme sites of the bacterial expression vector pQE-60 (Qiagen, Chatsworth Corporation, CA, 91311). pQE-60 encodes antibiotic resistance (Amp r ), ba...

Embodiment 2

[0140] The restriction enzyme sites correspond to the restriction enzyme sites of the bacterial expression vector pQE-60 (Qiagen, Chatsworth Corporation, CA, 91311). pQE-60 encodes antibiotic resistance (Amp r ), bacterial origin of replication (ori), IPTG regulatable promoter operator (P / O), ribosome binding site (RBS), 6-histidine tag and restriction endonuclease sites. pQE-60 was then digested with NcoI and BamHI. The amplified sequence was ligated into pQE-60 and inserted in frame with the histidine tag coding sequence and ribosome binding site (RBS). The ligation mixture was then used to transform E. coli strain M15 / rep4 (Qiagen, Inc.) by the method described by Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1989)). M15 / rep4 contains multiple copies of the plasmid pREP4, which expresses the lacI repressor and confers kanamycin resistance (Kan r ). Transformants were identified by their ability to grow on LB plates, and a...

Embodiment 3

[0143] Example 3 Cloning and expression of FGF-11 using the baculovirus expression system

[0144] The DNA sequence encoding the full-length FGF-11 protein (ATCC #97150) was amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene:

[0145] The FGF-11 5' primer has the sequence 5'CGCGGATCCATCATGAGTGGAAAGGTGACCAAG 3' (SEQ ID NO: 5) and contains a BamHI restriction site (bold) so that cloning at this site places the baculovirus signal sequence in the putative FGF -11 signal peptide cleavage site downstream of the FGF-11 gene 21 nucleotide reading frame.

[0146] The 3' primer has the sequence 5'CGCGGTACCCTACGTTGATTCATTGTGGCT 3' (SEQ ID NO: 6), contains a cleavage site for restriction endonuclease Asp718 and 21 nucleotides complementary to the 3'-untranslated sequence of the gene.

[0147] The amplified sequence was separated from a 1% agarose gel using a commercially available kit ("Geneclean" BIO 101 Company, La Jolla, Ca.). The fragmen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A human fibroblast growth factor-polypeptide 11, the DNA (RNA) for coding it, the process for preparing said polypeptide by recombination, the method for using said polypeptide in medical purpose, the antagon of said polypeptide and its medical application, and the diagnosing method by detecting the mutation in coding sequence and the change in polypeptide concentration are disclosed.

Description

[0001] This application is a divisional application of a Chinese patent application with an application date of June 5, 1995, an application number of 95197811.X, and an invention title of "Fibroblast Growth Factor 11". technical field [0002] The present invention relates to newly identified polynucleotides, polypeptides encoded by these polynucleotides, uses of these polynucleotides and polypeptides, and methods of production of these polynucleotides and polypeptides. More specifically, the polypeptides of the present invention have been putatively identified as fibroblast growth factor / heparin-binding growth factor (hereinafter "FGF-11"). The invention also relates to methods of inhibiting the action of these polypeptides. Background technique [0003] Fibroblast growth factors are a family characterized by binding to heparin (and thus also called heparin-binding growth factors (HBGF)). Expression of distinct members of these proteins, under specific temporal and spatia...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/14G01N33/68
Inventor胡静姗克雷格·A·罗森
OwnerHUMAN GENOME SCI INC