Active gene molecule nano cabin and its preparing method
A genetic and molecular technology, applied in the cross-fields of molecular mechanical devices, physics and life sciences, can solve problems such as methods and approaches that do not provide practical applications, single functions, and strong demonstrability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0032] In order to prepare a biosensor based on the active gene nanocabin, the device is used to detect the target gene whose sequence is 3'GACTCCTCCCCGGTCT5', the following steps are taken:
[0033] (1) The DNA molecular unit used to constitute the gene nanocompartment is designed as follows: the length of the single-stranded part is 9 bases, the length of the double-stranded part is 16 bases, and 5'AAAAAAAAACTGAGGAGGGGCCAGA3'.
[0034] (2) A disc gold electrode with a diameter of 10 μm was prepared as the substrate of the probe of the biosensor.
[0035] (3) a mercapto-HS will be modified at the 5' end of the DNA molecular unit designed by step (1), then, the DNA molecular unit is made into a solution, and the solvent is 20mM Tris-HCl buffer solution (pH) containing 1mM magnesium ion =7.8). At the same time, an equal amount of oligonucleotide of 3'GACTCCTCCCCGGTCT5' sequence was prepared, dissolved in the same solvent, mixed with the above solution, and allowed to hybridize...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 