Unlock instant, AI-driven research and patent intelligence for your innovation.

Active gene molecule nano cabin and its preparing method

A genetic and molecular technology, applied in the cross-fields of molecular mechanical devices, physics and life sciences, can solve problems such as methods and approaches that do not provide practical applications, single functions, and strong demonstrability

Inactive Publication Date: 2003-06-25
PEKING UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This type of DNA molecular device is characterized by a single function and stronger demonstration than practicality. That is to say, it shows the possibility of technical realization of mechanical manipulation at the nanoscale and molecular level, but does not provide Any methods and approaches available for practical application
The other type is an oligofunctional device based on a large number of gene molecules compared to the former, which was first designed by scientists such as Hao Yan in 2002 (references: HaoYan, Xiaoping Zhang, Zhiyong Shen & Nadrian C. Seeman. A robust DNA mechanicaldevices controlled by hybridization topology.Nature, 415, (2002) 62-65), this new type of molecular device is composed of multiple mechanical units repeatedly arranged, each mechanical unit through DNA double hybrid molecule (Double Crossover DNA) The conversion between two topological isomers is used to achieve mechanical rotation. Since the double-hybrid molecular mechanical unit can be extended repeatedly over a long distance, the mechanical rotation of the mechanical unit can trigger the mechanical transmission, thereby achieving multi-level nanoscale mechanical handling. However, , although the nanomechanical function of this molecular device has been demonstrated, the problem of how to use it to the actual application system has not been further solved, and this molecular device still has a large distance from practical application
[0003] In general, the research on molecular mechanical devices has just started in the world. On the one hand, the research is relatively preliminary and the experiments are not rich enough;

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Active gene molecule nano cabin and its preparing method
  • Active gene molecule nano cabin and its preparing method
  • Active gene molecule nano cabin and its preparing method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0032] In order to prepare a biosensor based on the active gene nanocabin, the device is used to detect the target gene whose sequence is 3'GACTCCTCCCCGGTCT5', the following steps are taken:

[0033] (1) The DNA molecular unit used to constitute the gene nanocompartment is designed as follows: the length of the single-stranded part is 9 bases, the length of the double-stranded part is 16 bases, and 5'AAAAAAAAACTGAGGAGGGGCCAGA3'.

[0034] (2) A disc gold electrode with a diameter of 10 μm was prepared as the substrate of the probe of the biosensor.

[0035] (3) a mercapto-HS will be modified at the 5' end of the DNA molecular unit designed by step (1), then, the DNA molecular unit is made into a solution, and the solvent is 20mM Tris-HCl buffer solution (pH) containing 1mM magnesium ion =7.8). At the same time, an equal amount of oligonucleotide of 3'GACTCCTCCCCGGTCT5' sequence was prepared, dissolved in the same solvent, mixed with the above solution, and allowed to hybridize...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides an active gene molecule nano cabin as one mechanically operated on-off tool in molecular level. The active gene molecule nano cabin consists of several gene molecule units arranged repeatedly, and each gene molecule unit includes one section of double strand away from the substrate and one section of single strand near the substrate. The single strand has one end fixed to the surface of the solid substrate. The double strands of the gene molecule units arrange closely to form one compact molecular membrane layer, so that one nano leve high molecular carbin is formed between the molecular membrane layer and the solid substrate. The preparation process of the nano molecular cabin is also provided.

Description

Technical field: [0001] The invention belongs to the technical field of molecular mechanical devices (Molecular Mechanical Device) based on gene molecules, and belongs to the cross technical field of physics and life science. Background technique: [0002] Molecular mechanical devices based on gene molecules are a cutting-edge technology that has only begun to appear in recent years. In the current technology, the most basic ones are single-function devices based on a few gene molecules, and there are two typical ones as follows: first, the mechanical rotation of 180 degrees is realized by using the B-Z helical structure conversion of DNA (reference: Chengde Mao, Weiqiong Sun, Zhiyong Shen & Nadrian C. Seeman. A nanomechanical device based on the B-Z transition of DNA. Nature, 397, (1999) 144-146); Second, the use of hybridization of DNA molecules and polymorphism of secondary structures Sexual realization of molecular clamp (reference: Bernard Yurke, et al. ADNA-fueled mol...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): B81B7/04B82B3/00C12Q1/68G01N33/53
CPCC12Q1/68B82Y5/00B82Y30/00
Inventor 毛有东欧阳颀
Owner PEKING UNIV