Method of colibacillus expression alpha foetoprotein
A technology of alpha-fetoprotein and Escherichia coli, which is applied in the fields of biology and genetic engineering, can solve the problems of high price of alpha-fetoprotein and high cost of final products, and achieve the effects of low production cost, reduced production cost and good immunogenicity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Example 1 Method for expressing full-length alpha-fetoprotein in Escherichia coli: 1. Acquisition of human alpha-fetoprotein gene cDNA
[0022] Take human fetal liver tissue, use Trizol reagent (purchased from Gibco BRL company) to extract tissue total RNA, use Oligo dT(15) as primer to reverse transcribe into cDNA (reverse transcriptase purchased from Roche company) 2. human alpha-fetoprotein DNA fragment preparation
[0023] The primers for the full-length human alpha-fetoprotein gene were synthesized to amplify the full-length AFP gene. Restriction sites matching the vector are designed at both ends of the primers, with BamH I restriction sites upstream and Hind III restriction sites downstream.
[0024] AFP upstream 5’GC GGATTC AGA ACA CTG CAT AGA AAT G 3’
[0025] AFP downstream 5’AT AAGCTT TA AAC TCC CAA AGC AGC ACG 3’
[0026] High-fidelity PCR synthesis of AFPcDNA. Take 2ug for PCR product purification, and then digest with BamH I and HindIII in a 37-de...
Embodiment 2
[0037] Example 2 Method for expressing fragmented alpha-fetoprotein in Escherichia coli: 1. Acquisition of human alpha-fetoprotein gene cDNA
[0038] Human fetal liver tissue was taken, and total tissue RNA was extracted using Trizol reagent (purchased from Gibco BRL). cDNA was reverse transcribed with Oligo dT(15) as primer. 2. Preparation of human alpha-fetoprotein DNA fragment
[0039] Three pairs of primers were synthesized for the human alpha-fetoprotein gene, respectively amplifying the upper, middle and lower segments of the AFP gene (hereinafter referred to as AFP1, AFP2, and AFP3). Both ends of the primers are designed with restriction restriction sites matching the vector. The upstream contains a BamHI restriction site, and the downstream contains a Hind III restriction site.
[0040] Afp1up 5>GCGGATCCAGAACACTGCATAGAAATG<3
[0041] Afp1Down 5>CGCAAGCTTTGTTGCTGCCTTTGTTTGG<3
[0042] AFP2UP 5'>TGTGGATCCCCTGTATGCACCTACAATTC<3'
[0043] AfP2down 5>GCGAAGCTTTTCAAGAGG...
Embodiment 3
[0056] Example 3 Application of Escherichia coli to express alpha-fetoprotein
[0057]The alpha-fetoprotein expressed by Escherichia coli obtained by the method of the invention is used to immunize pigs according to procedures to prepare alpha-fetoprotein-specific transfer factors, which can significantly reduce the tumor size of liver cancer-bearing mice and prolong the survival time of animal models.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 