Unlock instant, AI-driven research and patent intelligence for your innovation.

Method of colibacillus expression alpha foetoprotein

A technology of alpha-fetoprotein and Escherichia coli, which is applied in the fields of biology and genetic engineering, can solve the problems of high price of alpha-fetoprotein and high cost of final products, and achieve the effects of low production cost, reduced production cost and good immunogenicity

Inactive Publication Date: 2004-03-03
ZHEJIANG UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the price of commercialized alpha-fetoprotein is relatively expensive, which makes the cost of the final product high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method of colibacillus expression alpha foetoprotein
  • Method of colibacillus expression alpha foetoprotein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1 Method for expressing full-length alpha-fetoprotein in Escherichia coli: 1. Acquisition of human alpha-fetoprotein gene cDNA

[0022] Take human fetal liver tissue, use Trizol reagent (purchased from Gibco BRL company) to extract tissue total RNA, use Oligo dT(15) as primer to reverse transcribe into cDNA (reverse transcriptase purchased from Roche company) 2. human alpha-fetoprotein DNA fragment preparation

[0023] The primers for the full-length human alpha-fetoprotein gene were synthesized to amplify the full-length AFP gene. Restriction sites matching the vector are designed at both ends of the primers, with BamH I restriction sites upstream and Hind III restriction sites downstream.

[0024] AFP upstream 5’GC GGATTC AGA ACA CTG CAT AGA AAT G 3’

[0025] AFP downstream 5’AT AAGCTT TA AAC TCC CAA AGC AGC ACG 3’

[0026] High-fidelity PCR synthesis of AFPcDNA. Take 2ug for PCR product purification, and then digest with BamH I and HindIII in a 37-de...

Embodiment 2

[0037] Example 2 Method for expressing fragmented alpha-fetoprotein in Escherichia coli: 1. Acquisition of human alpha-fetoprotein gene cDNA

[0038] Human fetal liver tissue was taken, and total tissue RNA was extracted using Trizol reagent (purchased from Gibco BRL). cDNA was reverse transcribed with Oligo dT(15) as primer. 2. Preparation of human alpha-fetoprotein DNA fragment

[0039] Three pairs of primers were synthesized for the human alpha-fetoprotein gene, respectively amplifying the upper, middle and lower segments of the AFP gene (hereinafter referred to as AFP1, AFP2, and AFP3). Both ends of the primers are designed with restriction restriction sites matching the vector. The upstream contains a BamHI restriction site, and the downstream contains a Hind III restriction site.

[0040] Afp1up 5>GCGGATCCAGAACACTGCATAGAAATG<3

[0041] Afp1Down 5>CGCAAGCTTTGTTGCTGCCTTTGTTTGG<3

[0042] AFP2UP 5'>TGTGGATCCCCTGTATGCACCTACAATTC<3'

[0043] AfP2down 5>GCGAAGCTTTTCAAGAGG...

Embodiment 3

[0056] Example 3 Application of Escherichia coli to express alpha-fetoprotein

[0057]The alpha-fetoprotein expressed by Escherichia coli obtained by the method of the invention is used to immunize pigs according to procedures to prepare alpha-fetoprotein-specific transfer factors, which can significantly reduce the tumor size of liver cancer-bearing mice and prolong the survival time of animal models.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A method for expressing alpha-fetoprotein in colibacillus includes such steps as obtaining alkpha-fetoprotein gene from human genom or other plasmids or by PCR, severing its two ends by endonuclease, and cloning it into colibacillus for stable expression. After purified, it can be used as antigen. Its advantages are high expression efficiency and low cost.

Description

technical field [0001] The invention belongs to biotechnology, relates to genetic engineering, and especially relates to a method for expressing alpha-fetoprotein in Escherichia coli, which is suitable for use as an antigen for immunizing animals and as an immunogen for detecting alpha-fetoprotein antibodies. Background technique [0002] Primary liver cancer is a common malignant tumor that endangers human health. Epidemiological survey found that primary liver cancer is closely related to chronic infection of HBV and HCV. my country is a high-incidence area of ​​viral hepatitis. At present, there are more than 100 million HBV and HCV infected people, which leads to a high incidence of liver cancer. According to statistics from the Ministry of Health, primary liver cancer has been the second leading cause of death among all tumors since the 1990s. Although the efforts of many oncology experts have achieved a variety of treatment methods such as surgery, chemotherapy, radi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12P21/00G01N33/53G01N33/574
Inventor 陈智朱海红周林福
Owner ZHEJIANG UNIV