Process for producing peptide

A technology of target peptide and cystyl peptide, applied in the field of peptide preparation

Inactive Publication Date: 2004-06-30
SHIMADZU SEISAKUSHO CO LTD
View PDF10 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Here, several target peptide genes are tried to be connected in series in one molecule, expressed in the form of a stable precursor protein in bacteria, and then the tandem repeat method of cutting out the target peptide is attempted, but there are few successful examples

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Process for producing peptide
  • Process for producing peptide
  • Process for producing peptide

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0076] In the production method A of the present invention, as the cleavage site of the enzyme that can be added to the N-terminal of the target peptide, such as

[0077] (1) Asp-Asp-Asp-Asp-Lys (SEQ ID NO: 58) (encoded by DNA containing base sequence: GATGACGACGACAAG (SEQ ID NO: 59)) which is a cleavage site of proteolytic enzyme enterokinase, etc.

[0078] (2) Ile-Glu-Gly-Arg (SEQ ID NO: 60) (encoded by DNA containing base sequence: ATTGAAGGCCGC (SEQ ID NO: 61)) which is a cleavage site of proteolytic enzyme factor Xa, etc.

[0079] (3) Gly-Pro-Arg (SEQ ID NO: 62) (encoded by DNA containing the base sequence: GGCCCGCGC (SEQ ID NO: 63)) which is the cleavage site of the proteolytic enzyme thrombin, etc.

[0080] As a chemical cleavage site that can be added to the N-terminal of the target peptide, for example, a methionine residue as a cyanogen bromide cleavage site, etc.

[0081] As a chemical cleavage site that can be added to the C-terminus of the target peptide, such as ...

Embodiment 1

[0263] (a) Preparation of gene encoding human GPR8 ligand (hGPR8L; SEQ ID NO: 44) in tandem three times

[0264] The following 10 kinds of DNA fragments (sequences 65-74 in the sequence listing) were used to prepare a structural gene encoding human hGPR8L ligand in tandem three times.

[0265] #1

[0266] 5'-

[0267] TATGGATGACGATGACAAATGGTAAAAACATGTGGCGAGCCCGCGTT

[0268] ATCATA CCG

[0269] (Sequence 65)

[0270]#2

[0271] 5'-

[0272] GCGCGGCCCACGGTATGATAACGCGGGCTCGCCACATGTTTATACCA

[0273] TTTGTCATCGTCATCCA

[0274] (Sequence 66)

[0275] #3

[0276] 5'-

[0277] TGGGCCGCGCGGCCGGTCTGCTGATGGGCCTGTGTCAATTGGGTTT

[0278] GAACTTCTCTGTCTCCGCCGCCGGAG

[0279] (Sequence 67)

[0280] #4

[0281] 5'

[0282] GATCCTCCGGCGGCGGAGACAGAGAAGTTCAAACCCAATTGACACA

[0283] GGCCCATCAGCAGACCGGCC

[0284] (Sequence 68)

[0285] #5

[0286] 5'-

[0287] AATTGGGTGGTGATGACGATGACAAATGGTATAAACATGTGGCGAGC

[0288] CCGCGTTATCATACCG

[0289] (Sequence 69)

[0290] #6

[0291] ...

Embodiment 2

[0322] Add 10 ml of 10 mM EDTA (pH6.0) to 2 g of the cells obtained in Example 1, and after ultrasonic treatment (BRANSON SONIFIER MODEL450), centrifuge (15000 rpm for 15 minutes). Repeat the same operation for the precipitate. After adding 5 ml of 7M guanidine solution (pH 5.0) to the precipitate, it was stirred for 2 hours and then centrifuged (15000 rpm for 15 minutes). Add 17 mg of Tris(2-carboxyethyl)-phosphine hydrochloride (TCEP-HCl) to the supernatant, perform a reduction treatment at 50° C. for 10 minutes, and then pass it through C4P-50 (1 cm×25 cm, Showa Electrician), after adsorption and cleaning, carry out gradient elution of 20-60% B (B: 80% acetonitrile / 0.1% trifluoroacetic acid) at a flow rate of 2ml / min, and collect the precursor protein fraction (elution time approx. 27 minutes), freeze-dried to obtain the freeze-dried powder of the precursor protein.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

An object of the present invention is to provide a method that can efficiently and mass-produce a target peptide by using a gene recombination method. The method of the present invention based on the combination of right-hand scissors (S-cyanation reaction) and left-hand scissors (cyanogen bromide treatment, enterokinase, factor Xa treatment, etc.) to cut out the target peptide and tandem repeat method can be used for large-scale synthesis of gene-based Peptides of recombinant technology, especially low molecular weight peptides.

Description

technical field [0001] The present invention relates to a method for preparing a target peptide or a salt thereof by stably expressing the target peptide in a microorganism in the form of a repeatedly linked precursor protein, and then breaking the peptide bond of the precursor protein. Background technique [0002] There are three known methods for synthesizing peptides: an organic chemical method, a method using enzymes, and a method using genetic recombination technology. [0003] Among them, it is very difficult to synthesize a peptide by a direct expression method in terms of a method using gene recombination technology. The reason is that even if the peptides can be directly expressed, the prepared peptides are rapidly decomposed one by one by the protease in the bacteria. [0004] Therefore, when using genetic recombination technology to synthesize peptides, the fusion protein method of expressing them in the form of a fusion protein with a protective protein is gene...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/09C07K1/12C07K5/083C07K5/103C07K14/47C07K14/705C12N1/21C12N15/62C12P21/02C12P21/06
CPCC12P21/06C12N15/62C12P21/02
Inventor西村纪末永正人伊藤隆司北田千惠子
OwnerSHIMADZU SEISAKUSHO CO LTD