Transduction peptide-humanized chloine acetylase fusion protein and its use

A technology of fusion protein and choline acetylation, applied in the direction of transferase, peptide/protein component, fusion polypeptide, etc., can solve the problems of no detection of anti-AchR antibody, decrease of ChAT expression and activity, high technical requirements, etc., and achieve low cost , simplified purification process, high energy effect

Inactive Publication Date: 2005-08-03
INST OF PHARMACOLOGY & TOXICOLOGY ACAD OF MILITARY MEDICAL SCI P L A
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Ohno et al. (Tsujino, A. et al. Proc. Nat. Acad. Sci. 2001, 98: 2017-2022) found ChAT in patients with congenital myasthenic syndrome with frequent fatal asphyxia (CMS-EA) Mutations occurred. The ChAT gene of 5 CMS-EA patients had 10 recessive mutations, one frameshift mutation, and 3 nonsense mutations, which greatly reduced the expression and activity of ChAT
Five patients had myasthenia symptoms since birth or early infancy, but no anti-AchR antibodies were detected, so the ChAT gene mutation is the cause of myasthenia symptoms in infants
Central nervous system diseases must be administered centrally. At present, the central administration methods mainly include implantation, transplantation, intracerebroventricular injection, and intracerebral transplantation of neural progenitor cells, etc., all of which have complex operations, high technical requirements, and risks. Major (infection, accident, etc.) issues

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transduction peptide-humanized chloine acetylase fusion protein and its use
  • Transduction peptide-humanized chloine acetylase fusion protein and its use
  • Transduction peptide-humanized chloine acetylase fusion protein and its use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Construction of transduction peptide-CHAT fusion protein carrier

[0032] The s-type of the human ChAT gene donated by Professor Engel of the Mayo Institute of Clinical Neurology in the United States was passed through PCR technology (primer design: the upstream primer is 5'GAATTCACCCTACTCCACAC CAGAGG; the downstream primer is 5'cttaagctaaccctccac. PCR reaction conditions, denaturation at 94°C for 60 sec, 55 ℃ renaturation 60 sec, 72 ℃ extension 90 sec, 30 cycles,) to convert S-ChAT into M-type ChAT.

[0033] according to Figure 5 and Figure 6 The construction route shown is to further construct the eukaryotic expression vector pcDNA-ChAT on the basis of obtaining the cloning vector pGEM-ChAT. pcDNA is a eukaryotic high-efficiency long-term and transient expression vector for mammalian cells. Its promoter CMV enables the vector to be expressed stably and non-replicatively at a high level in most mammalian cells. pGEM-ChAT and pcDNA3.1 (Invitrogen produc...

Embodiment 2

[0036] Example 2 Expression and purification of transduction peptide-CHAT fusion protein

[0037] The recombinant plasmid prepared by the method described in Example 1 pGEX-ChAT Transformed into Escherichia coli BL21 (E.coli BL21(DE3)pLysS was purchased from Beijing Tianwei Times Company), and induced to express the transduction peptide-CHAT fusion protein.

[0038] After culturing the bacteria overnight, re-inoculate 10% of the bacteria in the new LB medium the next day, shake the bacteria to about OD600=0.6, add IPTG with a final concentration of 1.0mmol / L to the medium, and induce culture at 30°C for 4 After 1 hour, the cells were lysed and the GST-transducing peptide-CHAT was extracted, digested with thrombin and purified, and detected by Western blotting.

[0039] Electrophoresis and transmembrane were carried out by conventional methods in Western blotting, goat anti-human CHAT polyclonal antibody (Chemicon International Co.) was added, rabbit anti-goat IgG labeled wit...

Embodiment 3

[0041] Example 3 Kinetic Characteristics of CHAT Content in Mouse Brain After Intravenous Injection of Transductive Peptide-CHAT or CHAT

[0042] 1 experimental group

[0043] Healthy male mice (Shanghai species, class II animals), body weight 25±1g. Provided by Animal Experiment Center of Academy of Military Medical Sciences. The mice were randomly divided into 2 groups with 3 mice in each group. The mice in group 1 were injected with 100 μg transducible peptide-CHAT or CHAT through the tail vein, and the brains were removed at different time points (0, 0.5, 1, 2, 5, 12 h) after the injection, and the CHAT activity was measured. The brains of mice in group 2 were injected with different concentrations (0-500 μg / mL) of transduction peptide-CHAT or CHAT 0.2 ml into their tail veins 2 hours later, and the CHAT activity was measured. Each of the above experiments was repeated 3 times.

[0044] 2 Determination of CHAT activity

[0045] Animals in each group were killed by dec...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a kind of fused transduction peptide-humanized choline acetylase protein and nucleic acid molecule connecting the nucleotide sequence of the said fusion protein. The present invention also relates to expression vector containing said nucleotide molecule. The present invention also relates to the use of the fusion protein in preparing medicine for treating neurodegeneration disease, preventing Alzheimer's disease, promoting learning memory function and promoting intelligence growth. The medicine composition containing the said fusion protein may be applied through injection, sublingual taking, aspiration, etc.

Description

field of invention [0001] The invention relates to a transduction peptide-human choline acetyltransferase fusion protein and nucleic acid molecules containing the nucleotide sequence encoding the fusion protein. The present invention also relates to expression vectors containing the above nucleic acid molecules. The present invention also relates to the use of the fusion protein for preparing medicines for treating neurodegenerative diseases or preventing Alzheimer's disease, promoting learning and memory functions, and promoting intelligence. The present invention particularly relates to a pharmaceutical composition containing the fusion protein, which can be administered in various ways such as injection, sublingual administration, lung inhalation, nasal mucosa, anal plug or skin absorption. Background of the invention [0002] The biosynthetic enzyme of acetylcholine (Ach)-choline acetyltransferase (choline acetyltransferase, ChAT, EC 2.3.1.6), is an important enzyme in ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K9/02A61K9/70A61K9/72A61K38/00A61K38/16A61K38/43A61K38/45A61M37/00A61P21/04A61P25/00A61P25/16A61P25/28C07K19/00C12N9/10C12N15/62C12N15/63
CPCC07K2319/00C12N9/1029A61K38/00A61P21/04A61P25/00A61P25/16A61P25/28
Inventor李前孙曼霁付爱玲
OwnerINST OF PHARMACOLOGY & TOXICOLOGY ACAD OF MILITARY MEDICAL SCI P L A