Beta-mannase gene and preparation thereof

A technology of mannanase and gene, applied in genetic engineering, DNA preparation, plant gene improvement, etc., can solve the problem that the fermentation level cannot meet the needs of industrial production

Inactive Publication Date: 2005-11-23
JIANGNAN UNIV
View PDF0 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the enzyme production level of β-mannanase obtained through strain screening and traditional strain improvement is generally 100u / mL (Yang Wenbo et al., 1995, Microbiology Bulletin), and the fermentation level cannot meet the needs of industrial production.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Beta-mannase gene and preparation thereof
  • Beta-mannase gene and preparation thereof
  • Beta-mannase gene and preparation thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0085] Example 1 Conditions and purification of Bacillus licheniformis ATCC14580 producing β-mannanase

[0086]On the basis of inorganic salt solution, add 15-25g / L locust bean gum as a carbon source, 5-20g / L peptone as a nitrogen source, the fermentation temperature is 37-40°C, and the inoculum size can be selected as 1%. , the filling volume is 70mL (250mL Erlenmeyer flask), and the pH can be selected as 7.0 under optional conditions. Under this process condition, the average enzyme activity of shake flask fermentation for 12h is 41.92u / mL, and the supernatant culture fluid is collected as crude enzyme solution, after purification, the specific enzyme activity reached 2862.4u / mg.

[0087] β-Mannanase activity assay used locust bean gum as substrate. The reaction mixed liquid contained 1.5 ml locust bean gum solution (5 g / L) prepared with 0.1 mol / L sodium acetate buffer (pH 5.8) and 0.02 ml appropriately diluted (about 20 U / ml) enzyme solution. The mixture was incubated at ...

Embodiment 2

[0088] Embodiment 2: Cloning of β-mannanase gene and construction of recombinant plasmid

[0089] Primers BL0-manS1ggcttgaggcgatgctgagcaaaat and BL0-manS2aaaggagagatatgggacggcgattc were designed according to the reported conserved sequence of the Bacillus β-mannanase gene, and a 550bp fragment was amplified by PCR using the chromosomal DNA of Bacillus licheniformis ATCC14580 as a template. The amplified fragment was analyzed as the gene encoding β-mannanase. Based on this, primers B0-manS3taagggagcggacaccctctatctt and B0-manS4aacgggcacgccttcattttcaa were designed. The chromosomal DNA of Bacillus licheniformis ATCC14580 was partially digested with Sau3AI, and the 3-4kb DNA fragment was recovered, which was used as a PCR template after self-circularization, and a 3.2kb band was amplified with primers BL0-manS3 and BL0-manS4, sequenced and analyzed. The nucleotide sequence of the full-length man gene was obtained by splicing with the 550bp DNA sequence.

[0090] The chromosomal...

Embodiment 3

[0091] Example 3: Expression of β-mannanase gene in Escherichia coli

[0092] The recombinant plasmid pBL-man was transformed into Escherichia coli JM109, and the recombinant Escherichia coli EC-man was obtained through double resistance selection of ampicillin and kanamycin.

[0093] Recombinant Escherichia coli EC-man was cultured in liquid LB (Amp+Kan) medium with a liquid volume of 35ml (250ml Erlenmeyer flask), 37°C, 200r / min. After culturing for 48 hours, the supernatant was centrifuged and analyzed for enzyme activity. The highest level of β-mannanase produced by recombinant Escherichia coli EC-man reached 0.9 mg / ml, which was about the enzyme activity of Bacillus licheniformis ATCC14580 under the optimal culture conditions. 59 times. Taking Escherichia coli JM109 (pBL-WZX) as a control, the 12h culture of the recombinant strain EC-man was analyzed by whole-cell SDS-PAGE, and the results were as follows: figure 2 As shown, the sample has an obvious expression band at...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Disclosed is a beta-mannase gene and preparation, which belongs to the field of biological genetic engineering. The invention provides the beta-mannase gene man originated from Bacillus licheniformis ATCC14580, the nucleic acid sequence of the gene man and the amino acid sequence of the corresponding protein, cloned carrier containing the gene man and the bacillus expression carrier pBL-man, and the highly performance expression in bacillus coli or bacillus. the invention can be applied to the construction of genetic engineering bacterium for the industrial production of the beta-mannase, the molecule transformation for the present beta-mannase genes, and the increase of level and quality for beta-mannase by means of biofermentation.

Description

technical field [0001] A β-mannanase gene and high-efficiency preparation belong to the technical field of microbial genetic engineering. Background technique [0002] β-1,4-D-mannanase, also referred to as β-mannanase (1,4-β-D-mannanmannanohydrolases, EC 3.2.1.78), is a class of enzymes that can hydrolyze β-1,4- Manno-oligosaccharides of D-mannosidic bonds, endohydrolase of mannan polysaccharides, which belong to hemicellulase. [0003] The wide distribution of β-mannan in nature brings space for the development and application of β-mannanase. With the recent development of natural hemicellulose resources and the discovery of the medicinal value of mannan oligosaccharides, the research and development of β-mannanase has entered a new stage, and it will be used in food, medicine, papermaking, oil extraction, biological bleaching And feed processing and other fields have been widely used. [0004] β-mannanase is mainly derived from microorganisms. Among the β-mannanases p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/56
Inventor王正祥石贵阳马骏双
OwnerJIANGNAN UNIV