Process of calpain inhibiting protein gene 475 site SNP label screening swine

A technology for inhibiting protein and calpain, applied in the field of livestock molecular biology, can solve the problem of difficulty in confirming the correlation of pork tenderness, and achieve the effect of reducing detection cost and improving detection efficiency.

Inactive Publication Date: 2006-08-30
SHANGHAI JIAO TONG UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, since the variation in the non-coding region does not affect the change of the protein, it is difficult to confirm the correlation between the gene mutation in the non-coding region and the tenderness of pork

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] 1.1 Research object

[0030] Since pork tenderness is a quantitative trait affected by multiple genes and affected by various environmental factors, in order to reduce the impact of the environment, all experimental pigs were raised at the same feeding level and slaughtered on the same day, referring to Chen Runsheng (2002) et al. The method used to determine the muscle tenderness of each sample.

[0031] The 110 pigs used in the experiment were all raised in Suzhou Sutai Group, 28 Meishan; 27 Sutai pigs, 15 Landrace×Sutai pig hybrids, 15 Large White×Sutai pigs, 25 Du×Chang×Da mongrel pig. SNP detection was performed by direct sequencing.

[0032] 1.2 Experimental methods and results

[0033] 1.2.1 RNA extraction

[0034] Pig ear tissue samples were collected from pig farms, quickly placed in liquid nitrogen, frozen and stored in a -80°C refrigerator in the laboratory, ready to extract total RNA from the tissue. 100 mg ear tissue sample was put into a homogenizer t...

Embodiment 2

[0048] A kit for screening pigs based on the SNP marker at position 475 of the calpain gene, as described in Example 1, the T→G mutation at position 475 in M20160 is closely related to pork tenderness. Therefore, specific primers for the calpain gene can be designed based on this SNP site for amplification and detection.

[0049] name

Sequence (5'-3')

concentration

upstream primer

AAAGGAACACCCAGAGCC

100pmol / μL

downstream primer

GACCGTTTCGTCATCTTCAC

100pmol / μL

PCR reaction solution

Containing Taq Enzyme dNTP Magnesium Ion PCR Reaction Buffer

[0050] Pig ear tissue samples were taken in pig farms, total RNA was extracted, and the reverse transcription reaction was carried out according to the method described in Example 1. The PCR primers in the kit were diluted to 1 pmol / μL, and the PCR reaction was carried out with the above kit using the extracted reverse transcription product as a template. PCR amplification ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

This invention relates to a method of calcium protease restrain albumen gene 475 place SNP mark filtration of pig, it belongs to domestic animal molecular biology technique field. The procedures includes that distilling of pig gene group RNA, reverse transcription PCR amplification of calcium protease restrain albumen gene, detecting of SNP mark and its correlative analysis to pork tenderness. The feature is that new SNP mark of pig calcium protease restrain albumen gene is separated and determined, one SNP mark propitious to pork is filtrated (475 place C to T), prime used to amplify the place us designed, and kit used for this method is designed. This invention used the correlative characters between the SNP of 475 place in encoding area of calcium protease restrain albumen gene and pork tenderness to provides a new molecule mark method for pig mark assistant selection and matching.

Description

technical field [0001] The invention relates to a method for screening pigs based on SNP markers. Specifically, the SNP marker at the 475th position in the calpain gene coding region is significantly correlated with the tenderness of pork, and is used as the SNP marker of pigs for auxiliary selection and selection. match. The invention belongs to the technical field of livestock molecular biology. Background technique [0002] SNP marker (single nucleotide polymorphism) refers to the DNA sequence polymorphism caused by the variation of a single nucleotide at the chromosome genome level, and the frequency of one allele in the population is not less than 1%. SNP markers can be divided into two forms in the genome: the first is a large number of single base variations throughout the genome; the second is the functional mutation of the gene coding region. The latter is also called cSNP (coding SNP) because it is distributed in the coding region of the gene. cSNPs often cause ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68
Inventor潘玉春王起山孙立彬孟和于丹丹
OwnerSHANGHAI JIAO TONG UNIV