Process of calpain inhibiting protein gene 475 site SNP label screening swine
A technology for inhibiting protein and calpain, applied in the field of livestock molecular biology, can solve the problem of difficulty in confirming the correlation of pork tenderness, and achieve the effect of reducing detection cost and improving detection efficiency.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0029] 1.1 Research object
[0030] Since pork tenderness is a quantitative trait affected by multiple genes and affected by various environmental factors, in order to reduce the impact of the environment, all experimental pigs were raised at the same feeding level and slaughtered on the same day, referring to Chen Runsheng (2002) et al. The method used to determine the muscle tenderness of each sample.
[0031] The 110 pigs used in the experiment were all raised in Suzhou Sutai Group, 28 Meishan; 27 Sutai pigs, 15 Landrace×Sutai pig hybrids, 15 Large White×Sutai pigs, 25 Du×Chang×Da mongrel pig. SNP detection was performed by direct sequencing.
[0032] 1.2 Experimental methods and results
[0033] 1.2.1 RNA extraction
[0034] Pig ear tissue samples were collected from pig farms, quickly placed in liquid nitrogen, frozen and stored in a -80°C refrigerator in the laboratory, ready to extract total RNA from the tissue. 100 mg ear tissue sample was put into a homogenizer t...
Embodiment 2
[0048] A kit for screening pigs based on the SNP marker at position 475 of the calpain gene, as described in Example 1, the T→G mutation at position 475 in M20160 is closely related to pork tenderness. Therefore, specific primers for the calpain gene can be designed based on this SNP site for amplification and detection.
[0049] name
Sequence (5'-3')
concentration
upstream primer
AAAGGAACACCCAGAGCC
100pmol / μL
downstream primer
GACCGTTTCGTCATCTTCAC
100pmol / μL
PCR reaction solution
Containing Taq Enzyme dNTP Magnesium Ion PCR Reaction Buffer
[0050] Pig ear tissue samples were taken in pig farms, total RNA was extracted, and the reverse transcription reaction was carried out according to the method described in Example 1. The PCR primers in the kit were diluted to 1 pmol / μL, and the PCR reaction was carried out with the above kit using the extracted reverse transcription product as a template. PCR amplification ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap