Method for increasing yield of streptomycete antibiotic and the strain thereof
A Streptomyces and antibiotic technology, applied in the field of breeding of high-yielding Streptomyces strains, can solve problems such as vague description of gene functions, and achieve the effects of overcoming blindness, increasing yield and improving antibiotic production.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Example 1: Improvement of antibiotic production by disrupting the nsdA gene in Streptomyces coelicolor
[0020] 1.1) Construction of the recombinant vector pHZ2718 comprising the nsdA gene that has been destroyed
[0021] Streptomyces coelicolor is the model strain for Streptomyces research, and it already has its own set of genome library plasmids. SC7A1 (Redenbach et al., 1996, A set of ordered cosmids and a detailed genetic and physical map for the 8Mb Streptomycescoelicolor A3(2) chromosome.Mol Microbiol, 21:77-96) is one of them, and its foreign fragment is 46kb in length , which contains the nsdA gene. Escherichia coli strain DH5α (Hanahan D. Studies on the transformation of E. coli with plasmamids. J Mol Biol, 1983, 166: 557-580) containing SC7A1 was cultured overnight at 37° C. in LB medium (as described later), The plasmid was extracted, digested with BglII, and a fragment of 18 kb was recovered. This fragment was combined with pHJL401 (Larson et al., 1986, T...
Embodiment 2
[0082] Embodiment 2: Utilize the nsdA gene in disrupting Streptomyces avermitilis to improve Abamectin production
[0083] 2.1) From the total DNA of Streptomyces avermitilis, clone the fragment comprising nsdA gene by PCR
[0084] (a) inoculate Streptomyces avermitilis NRRL8165 in 25ml YEME medium (as described later), cultivate at 30 ℃ for 40 hours, collect the mycelium that obtains, extract total DNA; (b) use Streptomyces avermitilis NRRL8165 The total DNA was used as a template, and the primers 5'CAGCCAGTCGTCGGTCAGTT, 5, CTCTCCCGCTCGCAGAACGC were used for PCR amplification. The PCR reaction program was: 96°C pre-denaturation for 10 minutes; 96°C denaturation for 1 minute, 58°C renaturation for 1 minute, and 72°C extension for 9 minutes 30 seconds, 25 cycles; 72°C extension for 5 minutes, 4°C to end the reaction. Agarose gel electrophoresis detection has obtained the band of about 5.7kb; (c) the band of 5.7kb that (b) is obtained is carried out agarose gel recovery, and ca...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 