Method for increasing yield of streptomycete antibiotic and the strain thereof

A Streptomyces and antibiotic technology, applied in the field of breeding of high-yielding Streptomyces strains, can solve problems such as vague description of gene functions, and achieve the effects of overcoming blindness, increasing yield and improving antibiotic production.

Inactive Publication Date: 2006-09-13
HUAZHONG AGRICULTURAL UNIVERSITY
View PDF1 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] Although the genome sequences of Streptomyces coelicolor and Streptomyces avermitilis have been determined and published, and the full sequence of nsdA is available in the Genbank database, the description of the function of this gene is still va

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for increasing yield of streptomycete antibiotic and the strain thereof
  • Method for increasing yield of streptomycete antibiotic and the strain thereof
  • Method for increasing yield of streptomycete antibiotic and the strain thereof

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0019] Example 1: Enhanced antibiotic production by disrupting the nsdA gene in Streptomyces coelicolor

[0020] 1.1) Construction of the recombinant vector pHZ2718 containing the disrupted nsdA gene

[0021] Streptomyces coelicolor is a model strain for Streptomyces research, and it already has its own set of genomic library plasmids. SC7A1 (Redenbach et al., 1996, A set of ordered cosmids and a detailed genetic and physical map for the 8Mb Streptomycescoelicolor A3(2)chromosome. Mol Microbiol, 21:77-96) is one of them, and its exogenous fragment is 46kb long , which contains the nsdA gene. E. coli strain DH5α containing SC7A1 (Hanahan D. Studies on the transformation of E. coli with plasmids. J Mol Biol, 1983, 166:557-580) was grown overnight at 37°C in LB medium (described later), The plasmid was extracted, digested with BglII, and a fragment of 18 kb was recovered. This fragment was combined with pHJL401 (Larson et al., 1986, The minimalreplicon of a streptomyces plasmid...

Example Embodiment

[0082] Embodiment 2: utilize the interrupted nsdA gene in Streptomyces avermitilis to improve avermectin output

[0083] 2.1) Cloning of a fragment containing the nsdA gene by PCR from the total DNA of Streptomyces avermitilis

[0084] (a) inoculate 25ml of YEME medium (as described later) with Streptomyces avermitilis NRRL8165, culture at 30°C for 40 hours, collect the obtained mycelium, and extract total DNA; (b) with Streptomyces avermitilis NRRL8165 The total DNA was used as the template, and the primers 5'CAGCCAGTCGTCGGTCAGTT, 5, CTCTCCCGCTCGCAGAACGC were used for PCR amplification. The PCR reaction program was: 96 °C pre-denaturation for 10 min; seconds, 25 cycles; extension at 72°C for 5 minutes, and the reaction was terminated at 4°C. Agarose gel electrophoresis detection, a band of about 5.7kb was obtained; (c) The 5.7kb band obtained in (b) was recovered by agarose gel and combined with the vector pGEM-T Easy (purchased from promega's AT clone kit) to carry out an ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a method to improve the yield of streptomycete antibiotics and the breeding selection of high yield streptomycete strain. The method includes: cloning the section containing nsdA gene to gain the recombination carrier containing nsdA gene section, constructing the destroyed recombination carrier of nsdA gene, transplanting the carrier to streptomycete, fitering and gainin streptomycete strain that the nsdA gene is destroyed, ttesting the strain to gain high yield strain. The invention supplies a new approach to improve streptomycete antibiotics.

Description

technical field [0001] The invention belongs to the technical field of using streptomyces to improve antibiotic production. It specifically relates to the breeding of high-yielding streptomyces strains, the construction of intermediate vectors and a method for improving antibiotic production by utilizing the cultivated streptomyces strains. The present invention utilizes destroying a gene to reach the method for improving the antibiotic production level of Streptomyces, applicant named this gene nsdA, it is an antibiotic produced in Streptomyces coelicolor (Streptomyces coelicolor) and Avermitilis (Streptomyces avermitilis) negatively regulated genes. The invention is based on destroying the gene in Streptomyces coelicolor and Streptomyces avermitilis, and utilizes newly transformed bacterial strains to increase the output of antibiotics. Background technique [0002] Streptomyces belong to a class of industrial microorganisms of great ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/67C12N15/31C12N1/21C12P1/04C12R1/465
Inventor 陶美凤应新王茜李文成余贞邓子新周秀芬
Owner HUAZHONG AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap