Gene of encoded photosensitive chromoprotein for preventing and controlling crop disease
A technology for phytochrome and plant disease prevention and control, applied in the field of target application, gene encoding phytochrome-like protein, can solve problems such as increasing agricultural costs, aggravating environmental pollution, drug residues, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1 Construction of Xanthomonas mutant library of cabbage black rot
[0025] Tn5gusA5 (Sharma, 1991) was introduced into Xcc wild-type strain 8004 using the shuttle plasmid pLAFR1 between E. Xcc::Tn5gusA5 insertion mutants were screened with resistance markers of Xcc, combined with the whole genome sequence of Xcc (genome sequence number NC 007086) and TAIL-PCR (Thermal Asymetric Interlaced-PCR) technology (Yao-Guang Liu, 1995), to determine the Tn5gusA5 The insertion position on the genome, and perform PCR verification on the insertion position. By investigating the phenotypic changes such as pathogenicity, extracellular enzyme activity, and extracellular polysaccharide synthesis of mutants, the pathogenicity-related genes are screened (Tang et al, 2005). The present invention relates to one of the new pathogenicity-related genes-XC4241 gene (phytochrome-like protein gene), its insertion mutant number is 064H01, and the screening process can be found in the refe...
Embodiment 2
[0026] Example 2 Cloning and sequence determination of XC4241 gene (phytochrome-like protein gene)
[0027] According to the gene sequence of XC4241 (see sequence listing, 1st to 2305th base), design primers (upstream primer GGGAATTC CGATGCCGCCGTGCCGCCGCCG and downstream primer GGTCTAGA GTCATGCCGATCCCGAGCACCG; PCR conditions 95°C 3min; 95°C 30sec, 60°C 30sec, 72°C 2.5min, 30 cycles; 72°C for 5min), using the total DNA of Xanthomonas cabbage black rot strain 8004 as a template, amplify the full-length sequence of the gene by PCR, and clone it into the cloning vector pGEM3Zf(+) In this method, the DNA nucleotide sequence (SEQ ID No.1) was determined on an ABI377 DNA automatic sequencer by the dideoxynucleotide method. The correct XC4241 gene sequence verified by sequencing was cloned into the shuttle vector pLAFRJ, and the recombinant plasmid pCXC4241 containing the gene was obtained. The plasmid was digested with EcoRI and XbaI, and besides a 22kb vector band, there was also a...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com