Unlock instant, AI-driven research and patent intelligence for your innovation.

Gene of encoded photosensitive chromoprotein for preventing and controlling crop disease

A technology for phytochrome and plant disease prevention and control, applied in the field of target application, gene encoding phytochrome-like protein, can solve problems such as increasing agricultural costs, aggravating environmental pollution, drug residues, etc.

Inactive Publication Date: 2007-04-25
GUANGXI UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

With the enhancement of pathogenic bacteria's resistance to drugs, the amount of pesticides is increasing, which not only aggravates environmental pollution and drug residues, but also greatly increases agricultural costs. Therefore, it is urgent to develop new strategies for disease prevention and treatment and new pollution-free drugs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene of encoded photosensitive chromoprotein for preventing and controlling crop disease
  • Gene of encoded photosensitive chromoprotein for preventing and controlling crop disease

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1 Construction of Xanthomonas mutant library of cabbage black rot

[0025] Tn5gusA5 (Sharma, 1991) was introduced into Xcc wild-type strain 8004 using the shuttle plasmid pLAFR1 between E. Xcc::Tn5gusA5 insertion mutants were screened with resistance markers of Xcc, combined with the whole genome sequence of Xcc (genome sequence number NC 007086) and TAIL-PCR (Thermal Asymetric Interlaced-PCR) technology (Yao-Guang Liu, 1995), to determine the Tn5gusA5 The insertion position on the genome, and perform PCR verification on the insertion position. By investigating the phenotypic changes such as pathogenicity, extracellular enzyme activity, and extracellular polysaccharide synthesis of mutants, the pathogenicity-related genes are screened (Tang et al, 2005). The present invention relates to one of the new pathogenicity-related genes-XC4241 gene (phytochrome-like protein gene), its insertion mutant number is 064H01, and the screening process can be found in the refe...

Embodiment 2

[0026] Example 2 Cloning and sequence determination of XC4241 gene (phytochrome-like protein gene)

[0027] According to the gene sequence of XC4241 (see sequence listing, 1st to 2305th base), design primers (upstream primer GGGAATTC CGATGCCGCCGTGCCGCCGCCG and downstream primer GGTCTAGA GTCATGCCGATCCCGAGCACCG; PCR conditions 95°C 3min; 95°C 30sec, 60°C 30sec, 72°C 2.5min, 30 cycles; 72°C for 5min), using the total DNA of Xanthomonas cabbage black rot strain 8004 as a template, amplify the full-length sequence of the gene by PCR, and clone it into the cloning vector pGEM3Zf(+) In this method, the DNA nucleotide sequence (SEQ ID No.1) was determined on an ABI377 DNA automatic sequencer by the dideoxynucleotide method. The correct XC4241 gene sequence verified by sequencing was cloned into the shuttle vector pLAFRJ, and the recombinant plasmid pCXC4241 containing the gene was obtained. The plasmid was digested with EcoRI and XbaI, and besides a 22kb vector band, there was also a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a phathopoiesis related gene (photosensitive pigment-protein gene) from Xanthomonas causing cabbage black rot. The photosensitive pigment-protein gene provided by the invention contains one of the following nucleotide sequences: 1) DNA sequence shown in SEQ ID No.1, 2) DNA sequence containing over 80% homology with DNA sequence shown in SEQ ID No. 1. The invention also involves the application of the genes in plant disease prevention and cure, as well as the application for drug target in plant disease prevention and cure.

Description

technical field [0001] The invention relates to the field of plant disease prevention and control, more specifically, the invention relates to a gene encoding phytochrome-like protein for preventing and controlling crop diseases. The present invention also relates to the application of the gene in plant disease control and as the target of medicine for plant disease control. Background technique [0002] Plant diseases have always been one of the main factors that reduce crop yield and quality. With the enhancement of pathogenic bacteria's resistance to drugs, the amount of pesticides is increasing, which not only aggravates environmental pollution and drug residues, but also greatly increases agricultural costs. Therefore, it is urgent to develop new strategies for disease prevention and treatment and new pollution-free drugs . Understanding the genetic mechanism of plant pathogens infecting hosts is the key to developing new drugs and disease control strategies. [0003...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/31C12N15/63C12N15/82
Inventor 姜伯乐唐纪良何勇强唐东阶姜伟韦红玉臧宁韦珂张穗生
Owner GUANGXI UNIV