Pichia pastoris omega3-fatty acid dehydrogenase promoter sequence and use thereof

A fatty acid dehydrogenase and promoter sequence technology, applied in the biological field, can solve the problems of promoter sequence cloning and analysis that have not yet been reported, and achieve the effect of major application prospects.

Inactive Publication Date: 2007-05-23
NANKAI UNIV
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although ω has been cloned from a variety of organisms 3 - Fatty acid dehydrogenase gene sequence, but the cloning and analysis of its promoter sequence has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pichia pastoris omega3-fatty acid dehydrogenase promoter sequence and use thereof
  • Pichia pastoris omega3-fatty acid dehydrogenase promoter sequence and use thereof
  • Pichia pastoris omega3-fatty acid dehydrogenase promoter sequence and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Example 1. Isolation of Pichia pastoris ω3-fatty acid dehydrogenase gene promoter sequence (ppw3P)

[0061] The total DNA of Pichia pastoris was extracted, and the genome was digested with SalI. Using the fragment (663bp-1090bp, SEQ ID NO: 2) obtained by double digestion (BamHI&SalI) of the open reading frame of Mortierella isabellina (Mortierellaisabellina) Δ6-fatty acid dehydrogenase as a linker, the genome and linker after enzyme digestion were molar ratio 1 :3 ratio for overnight ligation. Design and synthesize the following three primers:

[0062] Primer 1: GAACTCCTCAGCGGTGTATGGAACAAAGAC

[0063] Primer 2: ATGACCTGTT GCCTTATGAT GC

[0064] Primer 3: GGCGATTGT GTTCTCGCTC

[0065] Using the ligation product as a template, perform a PCR reaction:

[0066] Reaction component Addition amount

[0067] Buffer (10×)

[0068] (Containing 20mmol / L MgCl 2 ) 5μl

[0069] dNTP (2.5mmol / L) 2μl

[0070] Primer 1 (1μmol / L) 2μl

[0071] Primer 2 (1μmol / L) 2μl

[0072] T...

Embodiment 2

[0078] Embodiment 2: Construction of Saccharomyces cerevisiae recombinant expression vector

[0079] According to the sequence shown in SEQ ID NO: 1, 392-779, gene-specific amplification primers (primers 5 and 6) were designed to isolate its potential promoter sequence:

[0080] Primer 4: 5-GGCAAGCTTATGTCAAAAGTCACTGTTTCGGG-3`;

[0081] Primer 5: 5`GCCTCTAGATTAGGTATCCTTAGG-3`;

[0082] Primer 6: 5`-GGCGGTACCGCCGAAGAAAGTAGAAGAGAAG-3`

[0083] The 5' ends of primers 4 and 5 contain HindIII and XbaI restriction sites respectively, which are used to separate ω 3 - Open reading frame (ppw3) of fatty acid dehydrogenase. The 5' ends of primers 6 and 5 contain KpnI and XbaI restriction sites respectively, which are used to separate ω 3 - Open reading frame of fatty acid dehydrogenase and its potential promoter sequence (ppw3p). The amplification conditions and reaction components used were the same as above, and then 50 μl of the PCR product and 1 μl of pYEP356 were respectively s...

Embodiment 3

[0084] Example 3: Electric shock-mediated transformation of recombinant plasmid Saccharomyces cerevisiae

[0085] Saccharomyces cerevisiae strain INVSc1 was streak-inoculated from a glycerol tube on a YEPD plate, and cultured at 30°C for 48 hours for activation; a single colony was picked and cultured in 5ml YEPD liquid medium, shaken at 30°C and 250rpm overnight; the OD of the bacterial liquid was detected 600 value, take an appropriate amount of bacterial solution and dilute it in 50ml YEPD liquid medium to make the OD 600 =0.4, continue to culture for 2-4h: centrifuge the cells at 2500rpm, remove the supernatant, add 50ml ice-bathed sterile water to wash twice, and ice-bath 1mol / L sorbitol to wash twice; 2ml 1mol / L sorbitol Resuspend the cells in alcohol and aliquot them in 100 μl / tube, and use them on ice as soon as possible. Add 10 μg of recombinant expression plasmid to 100 μl of competent yeast cells and mix gently; set the MicroPulser to the “ScaI” block, the paramete...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates toOmega3- fatty acid dehydrogenase promoter sequence separated from Pichia Pastoris and its application. The invention comprises SEQ ID NO:1. The invention includes the microbiological gene engineering method of changing microbiological cells protein components with the promoter sequence, and comprises: connecting heterogenic or homologous gene to the promoter downstream, transferring into microbiological expression vector, transforming microorganism host for the expression of target protein in its cells to realize quality improvement or medical use. Omega3- fatty acid dehydrogenase promoter sequence separated from Pichia Pastoris can be used in all the transgenic microorganisms.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to an ω3-fatty acid dehydrogenase promoter sequence isolated from Pichia pastoris and its application. The method and application of cloning the ω3-fatty acid dehydrogenase promoter from the total DNA of Pichia pastoris, connecting with different expression vectors, transforming different microorganisms, and making the transgenic microorganisms express the downstream genes. Background technique [0002] PUFAs (polyunsaturated fatty acids) exist in cells in various forms, such as cell membranes, storage lipids, triglycerides, sphingolipids, and lipoproteins, and perform different biological functions in cells. There are two main types of PUFAs, n-6 and n-3, which are represented by linoleic acid (Linoleic acid, LA as 18:2 9,12 n-6) and α-Linolenic acid (α-Linolenic acid, ALA expressed as 18:3Δ 9,12,15 n-3) is synthesized from the substrate. The two types of unsaturated fatty acids not...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/31C12N15/63C12N1/19C12N1/21
Inventor李明春张昕欣魏东盛邢来君周皓
OwnerNANKAI UNIV