Human myocardial troponin I subunit nucleic acid adaptor and its application

A cardiac troponin, subunit nucleic acid technology, applied in the biological field, can solve the problems of interference factors, difficult to establish cTnI standardization, different antibody titers, etc., and achieve high affinity and specificity, repeatability and stability. The effect of good and good application prospects

Inactive Publication Date: 2007-06-06
INST OF HYGIENE & ENVIRONMENTAL MEDICINE PLA ACAD OF MILITARY MEDICAL
View PDF0 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the existing antibody-based detection technology has inherent limitations, such as: ①Different manufacturers, different antibodies, and different batches produce different titers of antibodies; ②There are strict conditions for storage and use of antibodies, such as: temperature, pH value, osmotic pressure; ③ in the reaction, there are many interference factors
It is difficult to establish the standardization of detection of cTnI

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human myocardial troponin I subunit nucleic acid adaptor and its application
  • Human myocardial troponin I subunit nucleic acid adaptor and its application
  • Human myocardial troponin I subunit nucleic acid adaptor and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] A human cardiac troponin I subunit nucleic acid aptamer, characterized in that it has the nucleotide sequence described in SEQ ID No.1 in the sequence listing or has the nucleotide sequence described in SEQ ID No.2 in the sequence listing Sequence or the nucleotide sequence described in SEQ ID No.3 in the Sequence Listing.

[0031] The nucleotide sequence described in SEQ ID No.1:

[0032] cccctgcagg tgattttgct caagtcgaga gcggtgcatc tagggtctct agctcgggaa

[0033] agtatcgcta atcaggcgga t 81

[0034] Nucleotide sequence described in SEQ ID No.2:

[0035] cccctgcagg tgattttgct caagtgctta atcgagggta tcgtggggca gttgggaggg 60

[0036] agtatcgcta atcaggcgga t 81

[0037]Nucleotide sequence described in SEQ ID No.3:

[0038] cccctgcagg tgattttgct caagtgccgt caacatgtcc tagtaggggt ctcaggggtg 60

[0039] agtatcgcta atcaggcgga t 81

[0040] The single-stranded DNA random library and primers used in SELEX in the present invention are synthesized by Invitrogen, with fixed sequ...

Embodiment 2

[0042] Screening and preparation of a human cardiac troponin I subunit nucleic acid aptamer

[0043] Preparation of ssDNA library by PCR

[0044] The PCR reaction system is:

[0045] 10× amplification buffer 10ul

[0046] 4 kinds of dNTP mixture each 200umol / L

[0047] Primer 1 100pmol (5'CCCCT GCAGGTGATTTTGTCCAAGT 3')

[0048] Primer 2 100pmol (5'-biotin-ATCCGCCTGA TTAGCGAT ACT3')

[0049] Template DNA lug (5’CCCCTGCAGGTGATTTT GCTCAA GT-(N35)-AGTATCGCTAATCAGGCGGAT 3’)

[0050] Taq DNA Polymerase 2.5u

[0051] Mg 2+ 1.5mmol / L

[0052] Add double or triple distilled water to 100ul

[0053] The PCR reaction conditions were: pre-denaturation at 94°C for 3 min, then denaturation at 94°C for 40 s, annealing at 65°C for 1 min, extension at 72°C for 2 min, and finally extension at 72°C for 7 min.

[0054] A dsDNA library with biotin at the 3' end was amplified by PCR, and the dsDNA product was separated and purified, and combined with streptavidin magnetic beads; ...

Embodiment 3

[0057] Gel retardation assay to detect the binding of a human cardiac troponin I subunit nucleic acid aptamer to cTn I

[0058] The obtained human cardiac troponin I subunit nucleic acid aptamer (nucleotide sequence described in SEQ ID No.1 in the sequence listing) was denatured at 95° C. for 5 minutes, quickly ice-water bathed for 5 minutes, and 10 μl of binding buffer was added. Add different amounts of cTnI (0, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7 μg), and keep at 37° C. for 30 minutes (water bath). Load the sample to 5% polyacrylamide gel, electrophoresis, and observe the results by silver staining. As shown in Figure 1, gel hysteresis occurs after a human cardiac troponin I subunit nucleic acid aptamer binds to cTnI. No gel hysteresis without protein.

[0059] Different amounts of 0 μg, 0.1 μg, 0.2 μg, 0.3 μg, 0.4 μg, 0.5 μg, 0.6 μg, 0.7 μg of cTn I were incubated with 100 pmol of a human cardiac troponin I subunit nucleic acid aptamer for non-denaturation Polyacrylamide ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses one kind of human myocardial troponin I subunit nucleic acid adaptor and its application. The human myocardial troponin I subunit nucleic acid adaptor has the nucleotide sequence as shown and may be use in the early detection of myocardial troponin I, the clinical diagnosis of myocardial damage and the separation and purification of myocardial troponin I. The human myocardial troponin I subunit nucleic acid adaptor is oligonucleotide with relatively small molecular weight, may be synthesized chemically, and has affinity and specificity higher than that of antibody, easy labeling selectively in different parts, high repeatability and stability, easy preservation and excellent application foreground.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to the design and preparation of a group of human cardiac troponin I subunit nucleic acid adapters with high specificity and high affinity with human cardiac troponin I subunit (cTnI) by using molecular biology technology SELEX technology. Gametes and applications. Background technique [0002] Cardiovascular disease is a major fatal disease that endangers the health and life of our people. According to the statistics of the Ministry of Health in 2000, in my country's cities, 235 people died of cardiovascular and cerebrovascular diseases for every 100,000 people, accounting for The number one cause of death from various diseases. And increase at a rate of 2% every year. Acute myocardial infarction (AMI) is the main cause of death in cardiovascular patients. There are three diagnostic criteria for AMI recommended by WHO: (1) clinical history of ischemic chest pain; (2) dynamic evolution ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07H21/04C12N15/11A61K31/7088A61P9/00C12Q1/68C12N15/115
Inventor弓景波吴淑庆钱令嘉
OwnerINST OF HYGIENE & ENVIRONMENTAL MEDICINE PLA ACAD OF MILITARY MEDICAL