Thermal cycler including a temperature gradient block

a technology of temperature gradient and temperature cycler, which is applied in the direction of biomass after-treatment, analysis using chemical indicators, instruments, etc., can solve the problems of insufficient heating, difficult task, and inability to determine the optimum temperature for each of the various steps of any reaction system

Inactive Publication Date: 2002-09-12
STRATAGENE INC US
View PDF0 Cites 37 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Importantly, however, the determination of the optimum temperature for each of the various steps in any reaction system, and in particular for any nucleic amplification or incubation reaction involving an annealing step, is not a simple task.
Insufficient heating during the denaturation step is a common reason for a PCR reaction to fail.
However, overheating during the denaturation step can result in excessive denaturation of the polymerase.
An annealing temperature which is too low will result in non-specific DNA fragments being amplified.
At too high of an annealing temperature, the primers will anneal less efficiently resulting in decreased yield of the desired product and possibly reduced purity.
Thus, the number of subtle influences on the optimal annealing temperature makes difficult the task of quickly identifying the optimum for a given system,
Temperature may affect both the rate and the accuracy of the extension reaction.
If the rate of the polymerase reaction is too low, then the newly synthesized polynucleotide may not contain a site for primer annealing.
Determination of the optimal denaturing, annealing, and extension temperatures for a particular PCR is complicated by the fact that the optimum will be different for each of the reactions.
As a result, determination of the optimal temperature for running a PCR system can be a time consuming task.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Thermal cycler including a temperature gradient block
  • Thermal cycler including a temperature gradient block
  • Thermal cycler including a temperature gradient block

Examples

Experimental program
Comparison scheme
Effect test

example 1

Use of the Gradient Thermal Cycler for the Polymerease Chain Reaction

[0055] High temperature primer extension testing of the thermal gradient system of the invention was carried out using two model primer / template systems. These two systems exhibit significantly variable extension product yields depending upon the annealing temperature used during the extension process. Primer / template set #1 amplifies a 105 bp region of the human Gaucher gene, while set #2 amplifies a 540 bp region of the human fucosidase gene. The thermal gradient system of the invention contains a gradient block that allowed primer extension using an optimal annealing temperature range of 42 to 56.degree. C.

[0056] Methods and Materials

[0057] Primer extension reactions were carried out using the gradient block of the invention. Primer / template test set #1 consisted of a genomic human DNA template and two 22mer oligomers yielding a 105 bp extension product. The sequence of primer A was 5' CCTGAGGGCTCCCAGAGAGTGG 3'9...

example 2

Use of the Gradient Thermal Cycler for the Ligase Chain Reaction

[0063] Ligase chain reaction (LCR) is a recently described DNA amplification technique that can be used to detect trace levels of known nucleic acid sequences. LCR involves a cyclic two step reaction which is performed in a DNA thermal cycler machine. The first step is a high temperature melting step in which double stranded DNA unwinds to become single stranded. The second step is a cooling step in which two sets of adjacent, complementary oligonucleotides anneal to the single stranded target DNA molecules and are ligated together by a DNA ligase enzyme. The products of ligation from one cycle serve as templates for the ligation reaction of the next cycle. Thus, LCR results in the exponential amplification of ligation products.

[0064] Materials and Methods

[0065] The materials used in this experiment were obtained from Stratagene, La Jolla, Calif. The optimal temperature for the second step of the LCR cycle, in which the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
temperatureaaaaaaaaaa
temperatureaaaaaaaaaa
temperatureaaaaaaaaaa
Login to view more

Abstract

A method in which a temperature gradient is generated across a "gradient" block, and an apparatus comprising a block across which a temperature gradient can be generated. By setting up such a gradient, multiple reaction mixtures held in wells on the gradient block can be simultaneously run at temperatures which differ only slightly, thereby permitting an optimum temperature for the reaction to be quickly identified. In a preferred embodiment the gradient block is integrated into a thermal cycler used for nucleic acid amplification reactions.

Description

FIELD OF THE INVENTION[0001] The present invention relates to a temperature cycling apparatus useful for performing nucleic acid amplification, DNA sequencing and the like which apparatus can include single or multiple heating and / or cooling blocks containing sample wells wherein a temperature gradient can be generated across a given block.BACKGROUND OF THE INVENTION[0002] Systems which require multiple or cyclic chemical reactions to produce a desired product often require careful temperature control to produce optimal results. Such reactions include nucleic acid amplification reactions such as the polymerase chain reaction (PCR) and the ligase chain reaction (LCR). For this reason, apparatus have been developed which permit the accurate control of the temperature of reaction vessels in which such amplification reactions are performed.[0003] For example, there are a number of thermal "cyclers" used for DNA amplification and sequencing in the prior art in which one or more temperatu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(United States)
IPC IPC(8): B01L7/00C12M1/00C12M1/02C12M1/38G01N35/00G01N35/02G01N35/04
CPCB01L7/52B01L7/525B01L7/5255B01L7/54B01L2200/147B01L2300/0829B01L2300/1822B01L2300/1827B01L2300/1838B01L2300/1844G01N35/0099G01N35/028G01N2035/042Y10S435/809Y10T436/25
Inventor DANSSAERT, JOHN LEWISSHOPES, ROBERT JAMESSHOEMAKER, DANIEL DAVIS
Owner STRATAGENE INC US
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products