Recombinant adeno-associated virus virions for the treatment of lysosomal disorders

a technology of lysosomal disorders and adenovirus, which is applied in the field of lysosomal disorders treated with lysosomal disorders, can solve the problems of organ failure, premature death, and cellular structure distortion and compromise function

Inactive Publication Date: 2006-05-18
GENZYME CORP
View PDF17 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0029] In particular, results presented here show that subjects treated with AAV virions encoding β-glucuronidase (GUS), acquire the ability to produce GUS for extended time periods. Furthermore, treatment has a beneficial effect on the subject, as it reduces or eliminates GAG storage in tissues. Morever, intrathecal injection of AAV virions into the cerebrospinal fluid to both neonatal and adult animals, results in therapeutic levels of GUS in the brain and the elimination of storage granules in brain tissue.

Problems solved by technology

Typically, the undegraded molecules accumulate in the lysosomes to form storage vesicles, which eventually distort cellular structure and compromise function.
The result is a chronic and progressive condition that causes a variety of physiological problems often leading to organ failure and premature death.
Without GUS activity, GAGs cannot be completely catabolized and therefore accumulate in the lysosomes to form storage granules or vacuoles in almost all tissues.
This in turn results in animals that have distorted facial features, defects in skeletal development, dwarfism, reduced learning capacity, and early death at approximately 5 months of age (Birkenmeier et al.
All of these treatments provided measurable improvement, but none was entirely satisfactory.
Major problems that need to be overcome are the transient nature of enzyme replacement and adenoviral vector therapies, the invasiveness and potential complications of transplantation therapies, and the difficulty in restoring therapeutic GUS activity throughout the organism.
This results in hepatosplenomegaly, bone pain and fractures, mild anemia and leukopenia, and bleeding due to displacement of platelet precursors in the bone marrow.
Pulmonary infiltration by engorged macrophages can cause respiratory failure.
Bone pain gradually decreases, but X-ray abnormalities persist.
Enzyme therapy, however, does not improve CNS symptoms and can cost as much as $200,000 per year per patient.
It is therefore cost-prohibitive for some patients.
Some patients are therefore denied treatment despite likely benefit.
Additionally, treatment schedules minimize the effectiveness of enzyme treatment.
GC has a half life of approximately 10 minutes and isolated enzyme administration creates a flood of GC during treatment sessions and a lack of GC between treatments.
The short half life of GC also limits distribution.
This regimen adds further disruption and inconvenience to patients.
As macrophages filled with sphingomyelin infiltrate the lungs, bronchitis and pneumonia occur, with respiratory difficulties increasing throughout infancy.
There is currently no treatment for Neimann-Pick Disease.
There is no current treatment for the glycoprotein-related Lysosomal Storage Diseases.
Acid Lipase Deficiency results in massive accumulation of cholesterol esters and triglycerides in most tissues of the body.
In none of these cases, however, were experiments designed to show that the AAV-mediated gene therapy actually affected the long-term course of a disease.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant adeno-associated virus virions for the treatment of lysosomal disorders
  • Recombinant adeno-associated virus virions for the treatment of lysosomal disorders
  • Recombinant adeno-associated virus virions for the treatment of lysosomal disorders

Examples

Experimental program
Comparison scheme
Effect test

example 1

IM and IV AAV-GUS Virion Administration for the Treatment of MPS VII

[0149] The following examples detail intramuscular and intravenous delivery of AAV virions, which include the gene encoding β-glucuronidase gene (GUS), the enzyme deficient in individuals suffering from MPS VII (Sly Syndrome).

example 1a

Production of an MPS Animal Model

[0150] All procedures using mice were first reviewed and approved by an Institutional Animal Care and Use Committee and adhered to the principles of the NIH ‘Guide for the Care and Use of Laboratory Animals.’

[0151] Gusmps / + mice in the original C57BL / 6 (B6) background were obtained from E. Birkenmeier (Jackson Laboratory, Bar Harbor, Me., USA) and were crossed to the congenic strain B6.Gusa (Pfister et al. (1982) Biochem Genet 20: 519-535). From the progeny, Gusmps / a ice were selected and were used to establish a breeding colony in which both parents were always Gusmps / a and progeny carried mps / a, a / a or mps / mps allele combinations. The introduction of the a allele was done to aid genotyping by PCR. The homozygous, mps / mps mice are homozygous for the mutant allele, mps, of the β-glucuronidasegene, Gus (Birkenmeier et al. (1989) J Clin Invest 83: 1258-1266), displayed disease symptoms and were essentially identical to the original mutants. Presumably...

example 1b

Recombinant AAV-GUS Virion Construction

[0154] Vector construction and virion production and purification were analogous to those in previous reports (Kessler et al. (1996) Proc Natl Acad Sci USA 93: 14082-14087; Malik et al. (1997) J Virol (1997) 71: 1776-1783; Matsushita et al. (1998) Gene Ther 5:938-945). AAV-GUS was made by inserting a mouse GUS cDNA sequence (SEQ ID NO:3) into the XhoI site of pV4.1, a plasmid containing a CMV promoter and flanking ITRs. The mouse DNA included 82 bp of genomic DNA 5′ to the GUS transcriptional start site, a full-length cDNA coding for the Gus-sa structural allele, and a piece of polylinker DNA including an XhoI site at the 3′ end.

[0155] Plasmid pV4.1 was constructed as follows.

[0156] A synthetic DNA encoding the restriction enzyme sites NotI-MluI-Ecl136II-SstII-SfuI-SmaI-SfuI-ClaI-BglII-SnaBI-BstEII-PmlI-RsrII-NotI and having the sequence CGGCCGCACGCGTGAGCTCCGCGGTTCGAATCCCGGGATTCGAACATCGATA AAAGATCTACGTAGGTAACCACGTGCGGACCGAGCGGCCGC (SEQ ID NO...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Fractionaaaaaaaaaa
Fractionaaaaaaaaaa
Fractionaaaaaaaaaa
Login to View More

Abstract

AAV expression vectors and recombinant virions produced using these vectors, which include genes coding for enzymes defective or missing in lysosomal storage disorders, are described. These recombinant AAV virions are useful in the treatment of a variety of lysosomal storage disorders and the methods described herein provide for long-term, sustained expression of the defective or missing enzyme.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application is a continuation of U.S. patent application Ser. No. 10 / 421,175, filed Apr. 22, 2003, which is a continuation of U.S. patent application Ser. No. 09 / 715,858, filed Nov. 17, 2000, now U.S. Pat. No. 6,582,692, from which applications priority is claimed under 35 U.S.C. § 120, and which claim the benefit of provisional patent applications No. 60 / 166,097, filed Nov. 17, 1999, and No. 60 / 215,430, filed Jun. 30, 2000, from which applications priority is claimed under 35 U.S.C. §119(e)(1), all of which applications are incorporated herein by reference in their entireties.[0002] This invention was made with support under NIH Grant 5 R01 DK54285-04 from the National Institutes of Health, U.S. Department of Health and Human Services. Accordingly, the United States Government may have certain rights in this invention.FIELD OF THE INVENTION [0003] The present invention relates to recombinant adeno-associated virus (AAV) expression...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K48/00C12N9/24C12N15/864
CPCA61K48/00C12N15/86C12N2750/14143C12N2830/008C12N2830/15C12N2830/42C12N2830/85C12N2840/44C12Y302/01031C12N9/2434A61P3/00
InventorPODSAKOFF, GREGORYWATSON, GORDONCOUTO, LINDAYANG, BIN
OwnerGENZYME CORP