Nanos knock-out that ablates germline cells
a germline cell and knock-out technology, applied in the field of gene editing nonhuman livestock animals, can solve the problems of affecting the function of somatic support cells, affecting the ai use of elite boars and bulls in the livestock breeding industry, and affecting the ai of recipients,
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
Design, Construction and Testing of Porcine NANOS2 TALEN Reagents
[0216]Porcine NANOS2 is located on chromosome 6, and constitutes a single exon encoding a protein of 138 amino acids. Multiple sequence alignment across independent pig sequences was carried out to identify potential single nucleotide polymorphisms (denoted by red dots FIG. 1), and where possible these were avoided during selection of TALEN binding sites. Potential sites for binding of porcine NANOS2 TALENs were identified close to the 5′ end of the gene utilising the tool freely available at www.zifit.partners.org. Three TALEN pairs were constructed using the Golden Gate TALEN assembly protocol (Cermak et al, NAR 2011 39(12):e82). The right TALEN assembly was cloned into destination vector pCAG-T7-TALEN (Sangamo)-FokI-KKR-Destination and the left into pCAG-T7-TALEN (Sangamo)-FokI-ELD-Destination. A diagnostic restriction digest was carried out using enzymes BspeI and StuI / AatII, and positive clones were confirmed by D...
example 2
Design, Construction and Testing of Bovine NANOS2 CRISPR Reagents
[0223]Potential target sites for sgRNAs were initially identified based on the presence of PAM sequences within either the coding sequence of the bovine NANOS2 gene or the sequence immediately flanking the coding sequence. Each potential site was analysed for potential off-target binding by using the BLAST algorithm (ncbi.nlm.nih.gov) to analyse the bovine genome for sequence matches. Nine potential sgRNA-binding sites were selected (three 5′ to the coding sequence, three within the coding sequence, and three 3′ to the stop codon) that appeared to have high specificity for the NANOS2 gene within the bovine genome.
[0224]For each identified sgRNA binding site, 2 guide sequences were designed; a 20-mer binding sequence, and a 19-, 18- or 17-mer binding sequence. See Table 1 and FIG. 12
TABLE 1oSL48caccggtctttgggaatataaaagforward oligo for bovine NANOS2 5′guide 1 20-meroSL49aaacatttatattcccaaagaccreverse oligo for bovine NA...
example 3
The CRISPR / Cas System for Genetic Ablation
[0231]Following successful validation in cell culture as shown in FIG. 4, the guide sequence was assembled with a T7 promoter and synthesized as a G-block from IDT technologies. Assembly with a T7 driven construct is necessary for in vitro transcription and production of RNA. Briefly, sgRNA was transcribed using T7 in vitro transcription kit (Ambion). Likewise, the Cas9 plasmid was obtained from Addgene (Plasmid #42234; Name: pMJ920), and the Cas9 mRNA was transcribed using T7 Megascript in vitro transcription kit (FIG. 9A).
[0232]Both Cas9 mRNA (100 ng / μ1), and sgRNA targeting NANOS2 (50 ng / μ1) were injected into 1-cell porcine zygotes using an Eppendorf Femtojet injector on a continuous flow setting. The injected embryos were allowed to progress to blastocyst stage (FIG. 9C) for an additional 6 days, DNA collected, and PCR amplified around the target site. The presence of target gene deletions (as a consequence of NHEJ repair) was assessed ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| temperature | aaaaa | aaaaa |
| temperature | aaaaa | aaaaa |
| pH | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More